ChooseItemDialog Choose task type Choose task type Add a task of the following type: Add a task of the following type: CreateExternalProcessWorkerDialog Create Element with Command Line Tool Create Element with Command Line Tool Element description Element description Name Name Description Description <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Name and description for new workflow element. Status: %1</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Name and description for new workflow element. Status: %1</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Input and output data for external tool. Name is a command line parameter for input/output data in external tool. Set data type and format in which external tool reads/writes input/output data. You also can set description for workflow designer. Each input data will be represented as port in workflow designer. Each output data will be represented as slot of single slot.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Input and output data for external tool. Name is a command line parameter for input/output data in external tool. Set data type and format in which external tool reads/writes input/output data. You also can set description for workflow designer. Each input data will be represented as port in workflow designer. Each output data will be represented as slot of single slot.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Name and description for new workflow element. Status: %1</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> </body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Input and output data for external tool. Name is a command line parameter for input/output data in external tool. Set data type and format in which external tool reads/writes input/output data. You also can set description for workflow designer. Each input data will be represented as port in workflow designer. Each output data will be represented as slot of single slot.</body></html> Input data Input data Add input Add input Delete Delete Output data Output data Add output Add output <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Another parameters for external tool. You must set name for parameter and its type. You also can set description for workflow designer. Each parameter will be represented as parameter of workflow element.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Another parameters for external tool. You must set name for parameter and its type. You also can set description for workflow designer. Each parameter will be represented as parameter of workflow element.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Another parameters for external tool. You must set name for parameter and its type. You also can set description for workflow designer. Each parameter will be represented as parameter of workflow element.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Execution string and element's description. To substitute input, output data or parameter, use it's name with prefix $ in execution string. You can set parameterized description for new element(description that appears not in property editor but on element itself). In parameterized description you also can use parameters substitution with prefix $.</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'Lucida Grande'; font-size:13pt; font-weight:400; font-style:normal;"> Execution string and element's description. To substitute input, output data or parameter, use it's name with prefix $ in execution string. You can set parameterized description for new element(description that appears not in property editor but on element itself). In parameterized description you also can use parameters substitution with prefix $.</body></html> Parameters Parameters Add attribute Add attribute <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Execution string and element's description. To substitute input, output data or parameter, use it's name with prefix $ in execution string. You can set parameterized description for new element(description that appears not in property editor but on element itself). In parameterized description you also can use parameters substitution with prefix $. If file paths in the execution string contain spaces, they must be enclosed with single quotes.</body></html> Command line template Command line template Execution string Execution string Parameterized description Parameterized description CreateScriptBlockDialog Create Element with Script Create Element with Script Name Name ScriptBlock ScriptBlock Description Description <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Evaluates user's script</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Evaluates user's script</body></html> Input Port Input Port Add input slot Add input slot Delete input slot Delete input slot Output Port Output Port Add output slot Add output slot Delete output slot Delete output slot Attributes Attributes Add Attribute Add Attribute Delete Attribute Delete Attribute Error Error Error occured while saving new actor. Can't write to current directory. Choose another directory for store user's elements Error occured while saving new actor. Can't write to current folder. Choose another folder for store user's elements Error occured while saving new actor. Can't write to current folder. Choose another folder for store user's elements ... ... DashboardsManagerDialog Dashboards Manager Dashboards Manager Check dashboards to show: Check dashboards to show: Check selected Check selected Uncheck selected Uncheck selected Remove selected Remove selected Select all Select all GalaxyConfigConfigurationDialog Create Galaxy config Create Galaxy config Cancel Cancel ... ... UGENE directory Destination directory Galaxy directory UGENE folder UGENE folder Destination folder Destination folder Galaxy folder Galaxy folder Create Create ImportSchemaDialog Import Workflow to Element Import Workflow to Element Input new element name: Input new element name: PaletteWidget Form Form PortAliasesConfigurationDialog Configure Port and Slot Aliases Configure Port and Slot Aliases Workflow ports Workflow ports Slot Slot Alias Alias Port alias Port alias Port type: Port type: Port alias: Port alias: Port description: Port description: QObject Removing Dashboards Removing Dashboards The following dashboards are about to be deleted: The following dashboards are about to be deleted: The following dashboard is about to be deleted: The following dashboard is about to be deleted: Empty text slot Empty text slot Empty sequence slot Empty sequence slot Error with sequence object Error with sequence object Empty annotations slot Empty annotations slot Empty alignment slot Empty alignment slot Error with alignment object Error with alignment object Unknown document format: %1 Unknown document format: %1 No target objects in the file: %1 No target objects in the file: %1 Error with annotations object Error with annotations object Pattern(s) Pattern(s) Semicolon-separated list of patterns to search for. Semicolon-separated list of patterns to search for. Pattern file Pattern file Load pattern from file in any sequence format or in newline-delimited format. Load pattern from file in any sequence format or in newline-delimited format. Patterns are not set. Set the '%1' or '%2' parameter or bind the input text slot Patterns are not set. Set the '%1' or '%2' parameter or bind the input text slot The minimum datasets count is %1. The current count is %2 The minimum datasets count is %1. The current count is %2 The maximum datasets count is %1. The current count is %2 The maximum datasets count is %1. The current count is %2 Input '%1' slot is not supplied Input '%1' slot is not supplied The format %1 does not support annotations The format %1 does not support annotations You opened obsolete workflow in XML format. It is strongly recommended to clear working space and create workflow from scratch. You opened obsolete workflow in XML format. It is strongly recommended to clear working space and create workflow from scratch. Sorry! This workflow is obsolete and cannot be opened. Sorry! This workflow is obsolete and cannot be opened. Breakpoints Breakpoints % % Element style Element style Scripting mode Scripting mode Can not create the folder: Can not create the folder: The file '%1' already exists The file '%1' already exists Can not copy the file here: Can not copy the file here: Run workflow Run workflow Extract Consensus from Assembly Extract Consensus from Assembly Extract the consensus sequence from the incoming assembly. Extract the consensus sequence from the incoming assembly. Algorithm Algorithm The algorithm of consensus extracting. The algorithm of consensus extracting. Keep gaps Keep gaps Set this parameter if the result consensus must keep the gaps. Set this parameter if the result consensus must keep the gaps. Messages in requested queue include info of the '%1' data type that is currently unsupported for view. No intermediate data will be displayed Messages in requested queue include info of the '%1' data type that is currently unsupported for view. No intermediate data will be displayed coverage coverage bases count bases count Save annotations Save annotations RemoteDBFetcherWorker List of IDs List of IDs File with IDs File with IDs SchemaAliasesConfigurationDialog Workflow elements Workflow elements Configure Parameter Aliases Configure Parameter Aliases Parameter Parameter Alias Alias Description Description StartupDialog Choose Output Folder Choose Output Folder Output Folder Output Folder Choose Output Directory Output Directory Note: you can change this option in the UGENE Application Settings (Settings > Preferences > Workflow Designer) Note: you can change this option in the UGENE Application Settings (Settings > Preferences > Workflow Designer) U2::ActorCfgModel N/A N/A U2::BreakpointManagerView &Break at element... &Break at element... Delete &all breakpoints Delete &all breakpoints &Delete &Delete Delete the selected breakpoints Delete the selected breakpoints &Enable or disable all breakpoints &Enable or disable all breakpoints H&ighlight selected item H&ighlight selected item &Hit Count... &Hit Count... Edit &labels... Edit &labels... &Condition... &Condition... U2::CfgExternalToolModel Name for command line parameter Name for command line parameter Type Type Read as Read as Write as Write as Description Description String value Text file Output file url U2::CfgExternalToolModelAttributes Name Name Type Type Description Description U2::ChooseItemDialog OK OK Cancel Cancel U2::CreateExternalProcessDialog Warning Warning You have changed the structure of the element (name, slots, attributes' names and types). All elements on the scene would be removed. Do you really want to change it? You could also reset the dialog to the initial state. You have changed the structure of the element (name, slots, attributes' names and types). All elements on the scene would be removed. Do you really want to change it? You could also reset the dialog to the initial state. Create Element Create Element Please set the input/output data. Please set the input/output data. Please set the command line to run external tool. Please set the command line to run external tool. Please set the name for the new element. Please set the name for the new element. Invalid symbols in the element name. Invalid symbols in the element name. Element with this name already exists. Element with this name already exists. For one or more parameter name was not set. For one or more parameter name was not set. Invalid symbols in a name. Invalid symbols in a name. The same name of element parameters was found The same name of element parameters was found You don't use parameter %1 in template string. Continue? You don't use parameter %1 in template string. Continue? Continue Continue Abort Abort Spaces in the element name. Spaces in the element name. It is the correct name It is the correct name U2::CreateScriptElementDialog Name Name type type Type Type OK OK Cancel Cancel error error Two identical types for input port Two identical types for input port two identical types for input port two identical types for input port Two identical types for output port Two identical types for output port two identical types for output port two identical types for output port Name for some attributes is empty Name for some attributes is empty Two attributes with name %1 Two attributes with name %1 Name for block is empty Name for block is empty Actor with this name already registered Actor with this name already registered Description for block is empty Description for block is empty Can't save user's workflow element Can't save user's workflow element U2::DashboardManagerHelper No Dashboards Found No Dashboards Found You do not have any dashboards yet. You need to run some workflow to use Dashboards Manager. You do not have any dashboards yet. You need to run some workflow to use Dashboards Manager. U2::DashboardsManagerDialog OK OK Name Name Folder Folder Confirm Confirm Cancel Cancel U2::EstimationDialog Workflow Estimation Workflow Estimation U2::ExtendedProcStyle Auto-resize to text Auto-resize to text U2::GalaxyConfigTask Create Galaxy config from existing workflow Create Galaxy config from existing workflow U2::ImportSchemaDialog Error Error Element name is empty Element name is empty Element name contains spaces Element name contains spaces Element name contains dots Element name contains dots Element name contains @ Element name contains @ An element with this name already exists An element with this name already exists U2::ItemViewStyle Background color Background color Font Font U2::LoadSamplesTask Load workflow samples Load workflow samples Sample dir does not exist: %1 Sample dir does not exist: %1 Failed to load sample: %1 Failed to load sample: %1 U2::LoadWorkflowSceneTask Load workflow scene Load workflow scene Undefined format: plain text or xml expected Undefined format: plain text or xml expected Error while parsing file: %1 Error while parsing file: %1 U2::LocalWorkflow::AlignToReferencePrompter Input sequence Input sequence Input sequence. Input sequence. Aligned data Aligned data Aligned data. Aligned data. Reference URL Reference URL A URL to the file with a reference sequence. A URL to the file with a reference sequence. unset unset Aligns each sequence from %1 to the reference sequence from %2. Aligns each sequence from %1 to the reference sequence from %2. U2::LocalWorkflow::AlignToReferenceTask Align to reference Align to reference U2::LocalWorkflow::AlignToReferenceWorker Align to Reference Align to Reference Align input sequences (e.g. Sanger reads) to the reference sequence. Align input sequences (e.g. Sanger reads) to the reference sequence. Can not read the reference file: Can not read the reference file: Can't read the file: Can't read the file: No reference sequence in the file: No reference sequence in the file: More than one sequence in the reference file: More than one sequence in the reference file: U2::LocalWorkflow::Alignment2SequencePrompter unset unset from %1 from %1 Split alignment%1 into sequences. Split alignment%1 into sequences. U2::LocalWorkflow::Alignment2SequenceWorker empty input alignment empty input alignment Input alignment Input alignment A alignment which will be split into sequences A alignment which will be split into sequences Output sequences Output sequences Converted sequences Converted sequences Split Alignment into Sequences Split Alignment into Sequences Splits input alignment into sequences Splits input alignment into sequences U2::LocalWorkflow::AminoTranslationPrompter unset unset from %1 from %1 U2::LocalWorkflow::AminoTranslationWorker Input Data Input Data An input sequence to translate in amino. An input sequence to translate in amino. Amino sequence Amino sequence Sequence has been translated. Sequence has been translated. Translate from Translate from What position would sequence translated from : first, second, third or from all positions. What position would sequence translated from : first, second, third or from all positions. Auto selected genetic code Auto selected genetic code Set if genetic code will be selected automatically. Set if genetic code will be selected automatically. Amino Translation Amino Translation Translate sequence into it's amino translation . Output a sequence. Translate sequence into it's amino translation . Output a sequence. Genetic code Genetic code Which genetic code should be used for translating the input nucleotide sequence. Which genetic code should be used for translating the input nucleotide sequence. Error on getting %1 sequence: Error on getting %1 sequence: U2::LocalWorkflow::AssemblyToSequencesPrompter unset unset %1 %1 Split %1 assemblies into sequences(reads) and puts them to the output. Split %1 assemblies into sequences(reads) and puts them to the output. U2::LocalWorkflow::AssemblyToSequencesTask Split Assembly into Sequences Split Assembly into Sequences U2::LocalWorkflow::AssemblyToSequencesWorker Split Assembly into Sequences Split Assembly into Sequences Splits assembly into sequences(reads). Splits assembly into sequences(reads). U2::LocalWorkflow::BaseDocWriter Document format not set Document format not set Invalid database reference Invalid database reference Empty destination path supplied Empty destination path supplied Unexpected data storage attribute value Unexpected data storage attribute value Unspecified URL to write %1 Unspecified URL to write %1 Can not create folder: %1 Can not create folder: %1 Can not open a file for writing: %1 Can not open a file for writing: %1 No data to write No data to write Nothing to write Nothing to write Unable to fetch data from a message Unable to fetch data from a message Save objects to a shared database Save objects to a shared database Writing to %1 [%2] Writing to %1 [%2] Save documents Save documents U2::LocalWorkflow::BaseWriteAssemblyWorker Assembly writer: NULL assembly object Assembly writer: NULL assembly object Build index (BAM only) Build index (BAM only) Build BAM index for the target BAM file. The file .bai will be created in the same folder. Build BAM index for the target BAM file. The file .bai will be created in the same folder. U2::LocalWorkflow::CASAVAFilterPrompter unset unset %1 %1 Filters FASTQ reads from %1 generated by CASAVA 1.8. Filters FASTQ reads from %1 generated by CASAVA 1.8. U2::LocalWorkflow::CASAVAFilterWorker CASAVA FASTQ Filter CASAVA FASTQ Filter Reads in FASTQ file produced by CASAVA 1.8 contain 'N' or 'Y' as a part of an idetifier. 'Y' if a read if filtered, 'N' if the read if the read is not filtered. The workflow cleans up the filtered reads. For example: @HWI-ST880:181:D1WRUACXX:8:1102:4905:2125 1:N:0:TAAGGG CTTACATAACTACTGACCATGCTCTCTCTTGTCTGTCTCTTATACACATCT + 111442222322324232AAFFHIJJJJJJIHIIF111CGGFHIG???FGB @HWI-ST880:181:D1WRUACXX:8:1102:7303:2101 1:Y:0:TAAGGG TCCTTACTGTCTGAGCAATGGGATTCCATCTTTTACGATCTAGACATGGCT + 11++4222322<CEE2<:3<3333333<A<CAFE:1?C??::C?00?BD90. Reads in FASTQ file produced by CASAVA 1.8 contain 'N' or 'Y' as a part of an idetifier. 'Y' if a read if filtered, 'N' if the read if the read is not filtered. The workflow cleans up the filtered reads. For example: @HWI-ST880:181:D1WRUACXX:8:1102:4905:2125 1:N:0:TAAGGG CTTACATAACTACTGACCATGCTCTCTCTTGTCTGTCTCTTATACACATCT + 111442222322324232AAFFHIJJJJJJIHIIF111CGGFHIG???FGB @HWI-ST880:181:D1WRUACXX:8:1102:7303:2101 1:Y:0:TAAGGG TCCTTACTGTCTGAGCAATGGGATTCCATCTTTTACGATCTAGACATGGCT + 11++4222322<CEE2<:3<3333333<A<CAFE:1?C??::C?00?BD90. Input File Input File Set of FASTQ reads files Set of FASTQ reads files Output File Output File Output FASTQ files Output FASTQ files Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output file name Output file name A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Custom Custom Input file Input file Workflow Workflow U2::LocalWorkflow::CDSearchPrompter unset unset from %1 from %1 For sequence %1 find conserved domains in database %2. For sequence %1 find conserved domains in database %2. U2::LocalWorkflow::CDSearchWorker Input sequence Input sequence The sequence to search the annotations for The sequence to search the annotations for Annotations Annotations Found annotations Found annotations Database Database Currently, CD-Search is offered with the following search databases: <ul><li>CDD - this is a superset including <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_NCBI_curated">NCBI-curated domains</a> and <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_external">data imported</a> from Pfam, SMART, COG, PRK, and TIGRFAM.</li><li>Pfam - a mirror of a recent Pfam-A database of curated seed alignments. Pfam version numbers do change with incremental updates. As with SMART, families describing very short motifs or peptides may be missing from the mirror. An HMM-based search engine is offered on the <a href="http://pfam.sanger.ac.uk/">Pfam</a> site.</li><li>SMART - a mirror of a recent SMART set of domain alignments. Note that some SMART families may be missing from the mirror due to update delays or because they describe very short conserved peptides and/or motifs, which would be difficult to detect using the CD-Search service. You may want to try the HMM-based search service offered on the <a href="http://smart.embl-heidelberg.de">SMART</a> site. Note also that some SMART domains are not mirrored in CD because they represent "superfamilies" encompassing several individual, but related, domains; the corresponding seed alignments may not be available from the source database in these cases. Note also that SMART version numbers do not change with incremental updates of the source database (and the mirrored CD-Search database).</li> <li>TIGRFAM - a mirror of a recent TIGRFAM set of domain alignments. An HMM-based search engine is offered on the <a href="http://www.jcvi.org/cms/research/projects/tigrfams/overview/">TIGRFAM</a> site.</li><li>COG - a mirror of the current COG database of orthologous protein families focusing on prokaryotes. Seed alignments have been generated by an automated process. An alternative search engine, "Cognitor", which runs protein-BLAST against a database of COG-assigned sequences, is offered on the <a href="http://www.ncbi.nlm.nih.gov/COG">COG</a> site.</li><li>KOG - a eukaryotic counterpart to the COG database. KOGs are not included in the CDD superset, but are searchable as a separate data set.</li></ul> More information about each database is provided in the section on <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource">Where does CDD content come from?</a>. Currently, CD-Search is offered with the following search databases: <ul><li>CDD - this is a superset including <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_NCBI_curated">NCBI-curated domains</a> and <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_external">data imported</a> from Pfam, SMART, COG, PRK, and TIGRFAM.</li><li>Pfam - a mirror of a recent Pfam-A database of curated seed alignments. Pfam version numbers do change with incremental updates. As with SMART, families describing very short motifs or peptides may be missing from the mirror. An HMM-based search engine is offered on the <a href="http://pfam.sanger.ac.uk/">Pfam</a> site.</li><li>SMART - a mirror of a recent SMART set of domain alignments. Note that some SMART families may be missing from the mirror due to update delays or because they describe very short conserved peptides and/or motifs, which would be difficult to detect using the CD-Search service. You may want to try the HMM-based search service offered on the <a href="http://smart.embl-heidelberg.de">SMART</a> site. Note also that some SMART domains are not mirrored in CD because they represent "superfamilies" encompassing several individual, but related, domains; the corresponding seed alignments may not be available from the source database in these cases. Note also that SMART version numbers do not change with incremental updates of the source database (and the mirrored CD-Search database).</li> <li>TIGRFAM - a mirror of a recent TIGRFAM set of domain alignments. An HMM-based search engine is offered on the <a href="http://www.jcvi.org/cms/research/projects/tigrfams/overview/">TIGRFAM</a> site.</li><li>COG - a mirror of the current COG database of orthologous protein families focusing on prokaryotes. Seed alignments have been generated by an automated process. An alternative search engine, "Cognitor", which runs protein-BLAST against a database of COG-assigned sequences, is offered on the <a href="http://www.ncbi.nlm.nih.gov/COG">COG</a> site.</li><li>KOG - a eukaryotic counterpart to the COG database. KOGs are not included in the CDD superset, but are searchable as a separate data set.</li></ul> More information about each database is provided in the section on <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource">Where does CDD content come from?</a>. Currently, CD Search is offered with the following search databases: <ul><li>CDD - this is a superset including <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_NCBI_curated">NCBI-curated domains</a> and <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_external">data imported</a> from Pfam, SMART, COG, PRK, and TIGRFAM.</li><li>Pfam - a mirror of a recent Pfam-A database of curated seed alignments. Pfam version numbers do change with incremental updates. As with SMART, families describing very short motifs or peptides may be missing from the mirror. An HMM-based search engine is offered on the <a href="http://pfam.sanger.ac.uk/">Pfam</a> site.</li><li>SMART - a mirror of a recent SMART set of domain alignments. Note that some SMART families may be missing from the mirror due to update delays or because they describe very short conserved peptides and/or motifs, which would be difficult to detect using the CD-Search service. You may want to try the HMM-based search service offered on the <a href="http://smart.embl-heidelberg.de">SMART</a> site. Note also that some SMART domains are not mirrored in CD because they represent "superfamilies" encompassing several individual, but related, domains; the corresponding seed alignments may not be available from the source database in these cases. Note also that SMART version numbers do not change with incremental updates of the source database (and the mirrored CD-Search database).</li> <li>TIGRFAM - a mirror of a recent TIGRFAM set of domain alignments. An HMM-based search engine is offered on the <a href="http://www.jcvi.org/cms/research/projects/tigrfams/overview/">TIGRFAM</a> site.</li><li>COG - a mirror of the current COG database of orthologous protein families focusing on prokaryotes. Seed alignments have been generated by an automated process. An alternative search engine, "Cognitor", which runs protein-BLAST against a database of COG-assigned sequences, is offered on the <a href="http://www.ncbi.nlm.nih.gov/COG">COG</a> site.</li><li>KOG - a eukaryotic counterpart to the COG database. KOGs are not included in the CDD superset, but are searchable as a separate data set.</li></ul> More information about each database is provided in the section on <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource">Where does CDD content come from?</a>. Annotate as Annotate as Name of the result annotations marking found conserved domains. Name of the result annotations marking found conserved domains. Local search Local search Perform the search on local machine or submit the search to NCBI for remote execution. Perform the search on local machine or submit the search to NCBI for remote execution. Expect value Expect value Modifies the <a href="http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml#expect">E-value</a> threshold used for filtering results. False positive results should be very rare with the default setting of 0.01 (use a more conservative, i.e. lower setting for more reliable results), results with E-values in the range of 1 and above should be considered putative false positives. Modifies the <a href="http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml#expect">E-value</a> threshold used for filtering results. False positive results should be very rare with the default setting of 0.01 (use a more conservative, i.e. lower setting for more reliable results), results with E-values in the range of 1 and above should be considered putative false positives. Database folder Database folder Specifies database folder for local search. Specifies database folder for local search. CD Search CD Search Finds conserved domains in protein sequences. In case conserved domains database is downloaded the search can be executed on local machine. The search also can be submitted to the NCBI for remote execution. Finds conserved domains in protein sequences. In case conserved domains database is downloaded the search can be executed on local machine. The search also can be submitted to the NCBI for remote execution. 'External tools' plugin has to be loaded. 'External tools' plugin has to be loaded. 'Remote blast' plugin has to be loaded. 'Remote blast' plugin has to be loaded. U2::LocalWorkflow::ComposeResultSubTask Compose alignment Compose alignment U2::LocalWorkflow::ConvertFilesFormatPrompter unset unset from %1 from %1 Convert file %1 to selected format if it is not excluded. Convert file %1 to selected format if it is not excluded. U2::LocalWorkflow::ConvertFilesFormatWorker File File A file to perform format conversion A file to perform format conversion File of selected format File of selected format Excluded formats Excluded formats Input file won't be converted to any of selected formats. Input file won't be converted to any of selected formats. Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Custom Custom Input file Input file Workflow Workflow The file does not exist: %1 The file does not exist: %1 Convert Format: result folder is empty, default workflow folder is used Convert Format: result folder is empty, default workflow folder is used Unknown file format: Unknown file format: File Format Conversion File Format Conversion Converts the file to selected format if it is not excluded. Converts the file to selected format if it is not excluded. U2::LocalWorkflow::ConvertSnpeffVariationsToAnnotationsPrompter unset unset Parses information in variations from %1 into annotations. U2::LocalWorkflow::ConvertSnpeffVariationsToAnnotationsWorker Input URL Input URL Input variation file URL. Convert SnpEff Variations to Annotations Parses information, added to variations by SnpEff, into standard annotations. Produced from the input file name U2::LocalWorkflow::DASAnnotationPrompter unset unset from %1 from %1 For each protein sequence %1, finds IDs of similar sequences using remote BLAST. Loads annotations for DAS sources using the first %2 ID(s). For each protein sequence %1, finds IDs of similar sequences using remote BLAST. Loads annotations for DAS sources using the first %2 ID(s). U2::LocalWorkflow::DASAnnotationWorker Input sequences Input sequences Protein sequences for annotation. Nucleotide sequences are skipped. Protein sequences for annotation. Nucleotide sequences are skipped. DAS annotations DAS annotations A set of annotations loaded from DAS sources using IDs of similar sequences. A set of annotations loaded from DAS sources using IDs of similar sequences. Max result IDs Max result IDs Use first IDs of similar sequences to load annotations. Use first IDs of similar sequences to load annotations. Database Database Database against which the search is performed: UniProtKB or clusters of sequences with 100%, 90% or 50% identity. Database against which the search is performed: UniProtKB or clusters of sequences with 100%, 90% or 50% identity. Min identity Min identity Minimum identity of a BLAST result and an input sequence. Minimum identity of a BLAST result and an input sequence. Feature sources Feature sources The DAS sources to read features from. The DAS sources to read features from. Threshold Threshold The expectation value (E) threshold is a statistical measure of the number of expected matches in a random database. The lower the e-value, the more likely the match is to be significant. The expectation value (E) threshold is a statistical measure of the number of expected matches in a random database. The lower the e-value, the more likely the match is to be significant. Matrix Matrix The matrix assigns a probability score for each position in an alignment. The matrix assigns a probability score for each position in an alignment. Filtering Filtering Low-complexity regions (e.g. stretches of cysteine in Q03751, or hydrophobic regions in membrane proteins) tend to producespurious, insignificant matches with sequences in the database which have the same kind of low-complexity regions, but are unrelated biologically. If 'Filter low complexity regions' is selected, the query sequence will be run through the program SEG, and all amino acids in low-complexity regions will be replaced by X's. Low-complexity regions (e.g. stretches of cysteine in Q03751, or hydrophobic regions in membrane proteins) tend to producespurious, insignificant matches with sequences in the database which have the same kind of low-complexity regions, but are unrelated biologically. If 'Filter low complexity regions' is selected, the query sequence will be run through the program SEG, and all amino acids in low-complexity regions will be replaced by X's. Gapped Gapped This will allow gaps to be introduced in the sequences when the comparison is done. This will allow gaps to be introduced in the sequences when the comparison is done. Hits Hits Limits the number of returned alignments. Limits the number of returned alignments. Annotate with DAS Annotate with DAS Finds similar protein sequence using remote BLAST.Using IDs of sequences found loads annotation for DAS sources.Nucleotide sequences are skipped if any supplied to input. Finds similar protein sequence using remote BLAST.Using IDs of sequences found loads annotation for DAS sources.Nucleotide sequences are skipped if any supplied to input. No DAS registry No DAS registry No DAS feature sources No DAS feature sources Internal error: no DAS Registry. Internal error: no DAS Registry. Sequence %1 is %2 amino acids long. Only sequences from %3 to %4 amino acids are processed. Sequence %1 is %2 amino acids long. Only sequences from %3 to %4 amino acids are processed. Bad sequence supplied to DASAnnotationWorker: %1 Bad sequence supplied to DASAnnotationWorker: %1 Number of similar sequences: %1. Number of similar sequences: %1. IDs: IDs: U2::LocalWorkflow::DNAStatWorker Input sequence Input sequence Sequence for which GC-content and GC3-content will be evaluated. Sequence for which GC-content and GC3-content will be evaluated. Result annotation Result annotation Resulted annotations, with GC-content and GC3-content. Resulted annotations, with GC-content and GC3-content. GC-content GC-content Evaluate GC-content. Evaluate GC-content. Evaluate GC1-content. Evaluate GC1-content. Evaluate GC2-content. Evaluate GC2-content. Evaluate GC3-content. Evaluate GC3-content. GC1-content GC1-content GC2-content GC2-content GC3-content GC3-content DNA Statistics DNA Statistics Evaluates statistics for DNA sequences. Evaluates statistics for DNA sequences. Sequence must be nucleotide Sequence must be nucleotide No statistics was selected No statistics was selected U2::LocalWorkflow::DNAStatWorkerPrompter Evaluates GC-Content and GC3-Content. Evaluates GC-Content and GC3-Content. U2::LocalWorkflow::ExternalProcessWorker output data output data %1 file was not created %1 file was not created U2::LocalWorkflow::ExternalProcessWorkerPrompter unset unset %1 %1 U2::LocalWorkflow::ExtractAssemblyCoverageWorker Empty assembly slot Empty assembly slot Error with assembly object Error with assembly object Extract Coverage from Assembly Extract Coverage from Assembly Extract the coverage and bases quantity from the incoming assembly. Extract the coverage and bases quantity from the incoming assembly. Format Format Format to store the output. Format to store the output. Export Export Data type to export. Data type to export. Threshold Threshold The minimum coverage value to export. The minimum coverage value to export. U2::LocalWorkflow::ExtractAssemblyCoverageWorkerPrompter coverage in "%1" format coverage in "%1" format nothing nothing Exports %1 from the incoming assembly with threshold %2 to %3 in tab delimited plain text format. Exports %1 from the incoming assembly with threshold %2 to %3 in tab delimited plain text format. U2::LocalWorkflow::ExtractConsensusTaskHelper Extract consensus Extract consensus Unknown consensus algorithm: Unknown consensus algorithm: U2::LocalWorkflow::ExtractConsensusWorker Empty assembly slot Empty assembly slot Error with assembly object Error with assembly object U2::LocalWorkflow::ExtractConsensusWorkerPrompter Extracts the consensus sequence from the incoming assembly using the %1 algorithm. Extracts the consensus sequence from the incoming assembly using the %1 algorithm. U2::LocalWorkflow::ExtractMSAConsensusSequenceWorker Extract Consensus from Alignment as Sequence Extract Consensus from Alignment as Sequence Extract the consensus sequence from the incoming multiple sequence alignment. Extract the consensus sequence from the incoming multiple sequence alignment. Consensus sequence Consensus sequence Provides resulting consensus as a sequence Provides resulting consensus as a sequence Algorithm Algorithm The algorithm of consensus extracting. The algorithm of consensus extracting. Threshold Threshold The threshold of the algorithm. The threshold of the algorithm. Keep gaps Keep gaps Set this parameter if the result consensus must keep the gaps. Set this parameter if the result consensus must keep the gaps. Extract Consensus from Alignment as Text Extract Consensus from Alignment as Text Extract the consensus string from the incoming multiple sequence alignment. Extract the consensus string from the incoming multiple sequence alignment. Extracts the consensus sequence from the incoming alignment(s) using the %1 algorithm. Extracts the consensus sequence from the incoming alignment(s) using the %1 algorithm. U2::LocalWorkflow::ExtractMSAConsensusStringWorker Input alignment Input alignment A alignment which consensus should be extracted A alignment which consensus should be extracted Consensus Consensus Provides resulting consensus as a text Provides resulting consensus as a text U2::LocalWorkflow::ExtractMSAConsensusTaskHelper Extract consensus Extract consensus Unknown consensus algorithm: Unknown consensus algorithm: U2::LocalWorkflow::ExtractMSAConsensusWorker Empty msa slot Empty msa slot Error with msa object Error with msa object U2::LocalWorkflow::FastQWriter Fastq writer: NULL sequence object Fastq writer: NULL sequence object U2::LocalWorkflow::FastqQualityTrimPrompter unset unset %1 %1 Trim input sequence %1 from the end, using the quality threshold. Trim input sequence %1 from the end, using the quality threshold. U2::LocalWorkflow::FastqQualityTrimWorker FASTQ Quality Trimmer FASTQ Quality Trimmer The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Input File Input File Set of FASTQ reads files Set of FASTQ reads files Output File Output File Output FASTQ files Output FASTQ files Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output file name Output file name A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Quality threshold Quality threshold Quality threshold for trimming. Quality threshold for trimming. Min Length Min Length Too short reads are discarded by the filter. Too short reads are discarded by the filter. Trim both ends Trim both ends Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS Input file Input file Workflow Workflow Custom Custom U2::LocalWorkflow::FetchSequenceByIdFromAnnotationPrompter unset unset %1 %1 In each annotation from %1 search for accession ID and download the corresponding sequences. In each annotation from %1 search for accession ID and download the corresponding sequences. U2::LocalWorkflow::FetchSequenceByIdFromAnnotationWorker Cannot create folder '%1' Cannot create folder '%1' failed to load item '%1' from '%2' DB : %3 failed to load item '%1' from '%2' DB : %3 Fetch Sequences by ID from Annotation Fetch Sequences by ID from Annotation Parses annotations to find any IDs and fetches corresponding sequences. Parses annotations to find any IDs and fetches corresponding sequences. Input annotations Input annotations The annotations are scanned for accesion ids. The annotations are scanned for accesion ids. Sequence Sequence The downloaded sequences The downloaded sequences U2::LocalWorkflow::FilterAnnotationsByQualifierPrompter unset unset Filter annotations from %1 by given qualifier name and value. Filter annotations from %1 by given qualifier name and value. U2::LocalWorkflow::FilterAnnotationsByQualifierTask Filter annotations by qualifier task Filter annotations by qualifier task U2::LocalWorkflow::FilterAnnotationsByQualifierWorker Input annotations Input annotations Annotations to be filtered by name. Annotations to be filtered by name. Result annotations Result annotations Resulted annotations, filtered by name. Resulted annotations, filtered by name. Qualifier name Qualifier name Name of the qualifier to use for filtering. Name of the qualifier to use for filtering. Qualifier value Qualifier value Text value of the qualifier to apply as filtering criteria Text value of the qualifier to apply as filtering criteria Accept or filter Accept or filter Selects the name filter: accept specified names or accept all except specified. Selects the name filter: accept specified names or accept all except specified. Filter Annotations by Qualifier Filter Annotations by Qualifier Filters annotations by Qualifier. Filters annotations by Qualifier. U2::LocalWorkflow::FilterAnnotationsPrompter unset unset Filter annotations from %1 by supplied names. Filter annotations from %1 by supplied names. U2::LocalWorkflow::FilterAnnotationsTask Filter annotations task Filter annotations task The list of annotation names to accept/filter is empty The list of annotation names to accept/filter is empty Too big annotation names file Too big annotation names file Not enough memory to load the file with annotation names Not enough memory to load the file with annotation names U2::LocalWorkflow::FilterAnnotationsWorker Input annotations Input annotations Annotations to be filtered by name. Annotations to be filtered by name. Result annotations Result annotations Resulted annotations, filtered by name. Resulted annotations, filtered by name. Annotation names Annotation names List of annotation names, separated by spaces, that will be accepted or filtered. List of annotation names, separated by spaces, that will be accepted or filtered. Annotation names file Annotation names file File with annotation names, separated by whitespaces, that will be accepted or filtered. File with annotation names, separated by whitespaces, that will be accepted or filtered. At least one of these parameters must be set: "Annotation names", "Annotation names file". At least one of these parameters must be set: "Annotation names", "Annotation names file". Accept or filter Accept or filter Selects the name filter: accept specified names or accept all except specified. Selects the name filter: accept specified names or accept all except specified. Filter Annotations by Name Filter Annotations by Name Filters annotations by name. Filters annotations by name. U2::LocalWorkflow::FilterBamPrompter unset unset %1 %1 Filter BAM/SAM files from %1 with SAMTools view. Filter BAM/SAM files from %1 with SAMTools view. U2::LocalWorkflow::FilterBamWorker Filter BAM/SAM files Filter BAM/SAM files Filters BAM/SAM files using SAMTools view. Filters BAM/SAM files using SAMTools view. BAM/SAM File BAM/SAM File Set of BAM/SAM files to filter Set of BAM/SAM files to filter Filtered BAM/SAM files Filtered BAM/SAM files Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output name Output name A name of an output BAM/SAM file. If default of empty value is provided the output name is the name of the first BAM/SAM file with .filtered extention. A name of an output BAM/SAM file. If default of empty value is provided the output name is the name of the first BAM/SAM file with .filtered extention. Output format Output format Format of an output assembly file. Format of an output assembly file. Region Region Regions to filter. For BAM output only. chr2 to output the whole chr2. chr2:1000 to output regions of chr 2 starting from 1000. chr2:1000-2000 to ouput regions of chr2 between 1000 and 2000 including the end point. To input multiple regions use the space seprator (e.g. chr1 chr2 chr3:1000-2000). Regions to filter. For BAM output only. chr2 to output the whole chr2. chr2:1000 to output regions of chr 2 starting from 1000. chr2:1000-2000 to ouput regions of chr2 between 1000 and 2000 including the end point. To input multiple regions use the space seprator (e.g. chr1 chr2 chr3:1000-2000). MAPQ threshold MAPQ threshold Minimum MAPQ quality score. Minimum MAPQ quality score. Accept flag Accept flag Only output alignments with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. Only output alignments with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. Skip flag Skip flag Skip alignment with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. Skip alignment with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. Custom Custom Input file Input file Workflow Workflow Unknown file format: Unknown file format: U2::LocalWorkflow::FindAllRegionsTask FindAllRegionsTask FindAllRegionsTask U2::LocalWorkflow::FindPrompter unset unset translated translated A substring must %1. A substring must %1. match a pattern exactly match a pattern exactly Maximum number of mismatches is %1. Maximum number of mismatches is %1. %1 pattern(s) %1 pattern(s) patterns from %1 patterns from %1 and %1 and %1 using pattern names using pattern names Searches regions in each sequence from %1 similar to %2%3. %4 Searches in %5 of a %6sequence. Outputs the regions found annotated as %7. Searches regions in each sequence from %1 similar to %2%3. %4 Searches in %5 of a %6sequence. Outputs the regions found annotated as %7. U2::LocalWorkflow::FindWorker Input Data An input sequence to search in. Pattern Annotations The regions found. The regions found. Name of the result annotations. Name of the result annotations. Use pattern name Use pattern name If patterns are loaded from a file, use names of pattern sequences as annotation names. The name from the parameters is used by default. If patterns are loaded from a file, use names of pattern sequences as annotation names. The name from the parameters is used by default. Max Mismatches Max Mismatches Maximum number of mismatches between a substring and a pattern. Maximum number of mismatches between a substring and a pattern. Allow Insertions/Deletions Allow Insertions/Deletions Takes into account possibility of insertions/deletions when searching. By default substitutions are only considered. Takes into account possibility of insertions/deletions when searching. By default substitutions are only considered. Support ambiguous bases Support ambiguous bases Performs correct handling of ambiguous bases. When this option is activated insertions and deletions are not considered. Performs correct handling of ambiguous bases. When this option is activated insertions and deletions are not considered. Search in Translation Search in Translation Translates a supplied nucleotide sequence to protein and searches in the translated sequence. Translates a supplied nucleotide sequence to protein and searches in the translated sequence. Qualifier name for pattern name Qualifier name for pattern name Name of qualifier in result annotations which is containing a pattern name. Name of qualifier in result annotations which is containing a pattern name. Find Pattern Find Pattern Searches regions in a sequence similar to a pattern sequence. Outputs a set of annotations. Searches regions in a sequence similar to a pattern sequence. Outputs a set of annotations. both strands both strands direct strand direct strand complement strand complement strand Load file with patterns Load file with patterns Null sequence supplied to FindWorker: %1 Null sequence supplied to FindWorker: %1 Empty pattern given Empty pattern given Find algorithm subtasks Find algorithm subtasks Found %1 matches of pattern '%2' Found %1 matches of pattern '%2' Annotate as Annotate as U2::LocalWorkflow::GFFWriter GFF writer: NULL sequence object GFF writer: NULL sequence object U2::LocalWorkflow::GenbankWriter Genbank writer: NULL sequence object Genbank writer: NULL sequence object U2::LocalWorkflow::GetFileListPrompter Gets paths of files: %1. Gets paths of files: %1. U2::LocalWorkflow::GetFileListWorker Paths read by the element. Paths read by the element. Output URL Output URL Input URL Input URL Produces URL(s) to files from specified folders. Produces URL(s) to files from specified folders. File List File List U2::LocalWorkflow::GroupPrompter Groups all incoming messages into one message. Groups all incoming messages into one message. Groups all incoming messages %1 of %2 slot data. Groups all incoming messages %1 of %2 slot data. by id by id by name by name by value by value U2::LocalWorkflow::GroupWorker Input data flow Input data flow Group size Group size Size of the created group. Size of the created group. Grouped output data flow Grouped output data flow Out slots Out slots Group slot Group slot Group operation Group operation Grouper Grouper Groups data supplied to the specified slot by the specified property (for example, by value). Additionally, it is possible to merge data from another slots associated with the specified one. Groups data supplied to the specified slot by the specified property (for example, by value). Additionally, it is possible to merge data from another slots associated with the specified one. U2::LocalWorkflow::ImportAnnotationsWorker Load documents with annotations Load documents with annotations Input annotations Input annotations Input annotation table. Read annotations will be added to it Input annotation table. Read annotations will be added to it Output annotations Output annotations Output annotation table Output annotation table Merge Annotations Merge Annotations Read input annotation table and merge it with supplied annotation tables. Read input annotation table and merge it with supplied annotation tables. Merge input annotations with annotations from %1. Merge input annotations with annotations from %1. U2::LocalWorkflow::KAlignSubTask Max region size: %1 Max region size: %1 Core region: %1-%2 Core region: %1-%2 The %1 algorithm is not found. Add the %1 plugin. The %1 algorithm is not found. Add the %1 plugin. The %1 algorithm is not found. Check that the %1 plugin is up to date. The %1 algorithm is not found. Check that the %1 plugin is up to date. U2::LocalWorkflow::LaunchExternalToolTask Launch external process task Launch external process task Running external process: %1 Running external process: %1 Can't launch %1 Can't launch %1 U2::LocalWorkflow::LoadMSATask File '%1' not exists File '%1' not exists Unsupported document format: %1 Unsupported document format: %1 Reading MSA from %1 [%2] Reading MSA from %1 [%2] Read MSA from %1 Read MSA from %1 U2::LocalWorkflow::LoadSeqTask File '%1' not exists File '%1' not exists Unsupported document format: %1 Unsupported document format: %1 Reading sequences from %1 [%2] Reading sequences from %1 [%2] Read sequences from %1 Read sequences from %1 U2::LocalWorkflow::MSAFromSequencesTask MSAFromSequencesTask MSAFromSequencesTask U2::LocalWorkflow::MSAWriter Empty alignment passed for writing to %1 Empty alignment passed for writing to %1 U2::LocalWorkflow::MarkSequencePrompter Adds one or several marks to the input sequence. Adds one or several marks to the input sequence. U2::LocalWorkflow::MarkSequenceWorker Location Location Location of sequence Location of sequence Sequence Sequence Marked sequence Marked sequence Sequence Marker Sequence Marker Adds one or several marks to the input sequence depending on the sequence properties. Use this element, for example, in conjunction with the Filter element. Adds one or several marks to the input sequence depending on the sequence properties. Use this element, for example, in conjunction with the Filter element. Markers Markers Markers. Markers. U2::LocalWorkflow::MergeBamPrompter unset unset %1 %1 Merge BAM files from %1 with SAMTools merge. Merge BAM files from %1 with SAMTools merge. U2::LocalWorkflow::MergeBamWorker Merge BAM files Merge BAM files Merge BAM files using SAMTools merge. Merge BAM files using SAMTools merge. BAM File BAM File Set of BAM files to merge Set of BAM files to merge Merged BAM File Merged BAM File Merged BAM file Merged BAM file Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output BAM name Output BAM name A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .merged.bam extention. A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .merged.bam extention. Custom Custom Input file Input file Workflow Workflow Unknown file format: Unknown file format: U2::LocalWorkflow::MergeFastqPrompter unset unset from %1 from %1 Merges input sequences %1. Merges input sequences %1. U2::LocalWorkflow::MergeFastqWorker FASTQ Merger FASTQ Merger Merges input sequences to one output file Merges input sequences to one output file Input File Input File Set of FASTQ reads files Set of FASTQ reads files Output File Output File Output FASTQ file Output FASTQ file Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output file name Output file name A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Custom Custom Input file Input file Workflow Workflow U2::LocalWorkflow::MultiplexerPrompter unset unset Gets one message from %1 and one message from %2, joins them into a single message, and transfers it to the output. Repeats this while there are available messages in both input ports. Gets one message from %1 and one message from %2, joins them into a single message, and transfers it to the output. Repeats this while there are available messages in both input ports. Gets one message from %1, joins it with each message from %2, and transfers the joined messages to the output. Repeats this for each message from %1. Gets one message from %1, joins it with each message from %2, and transfers the joined messages to the output. Repeats this for each message from %1. U2::LocalWorkflow::MultiplexerWorker Multiplexing rule Multiplexing rule First input port First input port The number of messages, received from "%1" (%2), does not correspond to the number of messages, received from "%3" (%4). Redundant messages were skipped. One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from this port is concatenated with messages from the other port. One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from this port is concatenated with messages from the other port. Second input port Second input port One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from the other port is concatenated with messages from this port. One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from the other port is concatenated with messages from this port. Multiplexed output Multiplexed output The port outputs multiplexed messages. The port outputs multiplexed messages. Specifies how to multiplex the input messages: <li>1 to 1 - the multiplexer gets one message from the first input port and one message from the second input port, joins them into a single message, and transfers it to the output. This procedure is repeated while there are available messages in both input ports.</li> <li>1 to many - the multiplexer gets one message from the first input port, joins it with each message from the second input port, and transfers the joined messages to the output. This procedure is repeated for each message from the first input port.</li> Specifies how to multiplex the input messages: <li>1 to 1 - the multiplexer gets one message from the first input port and one message from the second input port, joins them into a single message, and transfers it to the output. This procedure is repeated while there are available messages in both input ports.</li> <li>1 to many - the multiplexer gets one message from the first input port, joins it with each message from the second input port, and transfers the joined messages to the output. This procedure is repeated for each message from the first input port.</li> 1 to many 1 to 1 Multiplexer Multiplexer The element allows one to join two data flows into a single data flow, i.e. to join messages from two input ports into concatenated messages and send them to the output. The concatenation approach is determined by the Multiplexing rule parameter. The element allows one to join two data flows into a single data flow, i.e. to join messages from two input ports into concatenated messages and send them to the output. The concatenation approach is determined by the Multiplexing rule parameter. U2::LocalWorkflow::PairwiseAlignmentTask Can't translate read sequence to reverse complement Can't translate read sequence to reverse complement U2::LocalWorkflow::PassFilterPrompter unset unset %1 %1 Filters input data from %1 by value(s) %2. Filters input data from %1 by value(s) %2. U2::LocalWorkflow::PassFilterWorker Input values Input values Input values. Input values. Filtered data Filtered data Filter by value(s) Filter by value(s) Comma-separated list of values used to filter the input data. Comma-separated list of values used to filter the input data. Filter Filter Passes through only data that matches the input filter value (or values). Passes through only data that matches the input filter value (or values). U2::LocalWorkflow::QualityTrimPrompter unset unset %1 %1 Trim input sequence %1 from the end, using the quality threshold. Trim input sequence %1 from the end, using the quality threshold. U2::LocalWorkflow::QualityTrimWorker FASTQ Quality Trimmer FASTQ Quality Trimmer The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Input File Input File Set of FASTQ reads files Set of FASTQ reads files Output File Output File Output FASTQ files Output FASTQ files Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output file name Output file name A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Quality threshold Quality threshold Quality threshold for trimming. Quality threshold for trimming. Min Length Min Length Too short reads are discarded by the filter. Too short reads are discarded by the filter. Trim both ends Trim both ends Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS Custom Custom Input file Input file Workflow Workflow U2::LocalWorkflow::RCWorker Input sequence Input sequence The sequence to be complemented The sequence to be complemented Output sequence Output sequence Reverse-complement sequence Reverse-complement sequence Operation type Operation type Select what to do with sequence. Select what to do with sequence. Reverse Complement Reverse Complement Converts input sequence into its reverse, complement or reverse-complement counterpart Converts input sequence into its reverse, complement or reverse-complement counterpart Null sequence object supplied to FindWorker Null sequence object supplied to FindWorker Null sequence supplied to FindWorker: %1 Null sequence supplied to FindWorker: %1 Can't complement amino sequence Can't complement amino sequence Can't find complement translation Can't find complement translation U2::LocalWorkflow::RCWorkerPrompter unset unset from %1 from %1 Converts each input sequence %1 into its %2 counterpart. Converts each input sequence %1 into its %2 counterpart. U2::LocalWorkflow::RawSeqWriter Raw sequence writer: NULL sequence object Raw sequence writer: NULL sequence object U2::LocalWorkflow::ReadAnnotationsTask Read annotations from %1 Read annotations from %1 File '%1' does not exist File '%1' does not exist Unsupported document format: %1 Unsupported document format: %1 Reading annotations from %1 [%2] Reading annotations from %1 [%2] U2::LocalWorkflow::ReadAnnotationsWorker Read Annotations Read Annotations Reads annotations from files. All annotation file formats supported by UGENE are allowed as input to this element. Reads annotations from files. All annotation file formats supported by UGENE are allowed as input to this element. Annotations Annotations Annotations. Annotations. Mode Mode <ul><li>"Separate" mode keeps the tables as they are;</li><li>"Merge from file" unites annotation tables from one file into one annotations table;</li><li>"Merge from dataset" unites all annotation tables from all files from dataset;</li></ul> Annotation table name The name for the result annotation table that contains merged annotation data from file or dataset. Separate annotation tables Merge annotation tables from file Merge all annotation tables from dataset If the file contains more than one annotation table, Split mode sends them "as is" to the output, while Merge appends all the annotation tables and outputs the sole merged annotation table.In Merge files is the same as Merge but it operates with all annotation tables from all files of one dataset. If the file contains more than one annotation table, Split mode sends them "as is" to the output, while Merge appends all the annotation tables and outputs the sole merged annotation table.In Merge files is the same as Merge but it operates with all annotation tables from all files of one dataset. Split Split Merge Merge Merge files Merge files Reads annotations from %1. Reads annotations from %1. U2::LocalWorkflow::ReadAssemblyWorker Read Assembly Read Assembly Reads assembly from files. All assembly file formats supported by UGENE are allowed as input to this element. Reads assembly from files. All assembly file formats supported by UGENE are allowed as input to this element. Assembly Assembly Reads assembly from %1. Reads assembly from %1. U2::LocalWorkflow::ReadVariationTask Read variations from %1 Read variations from %1 File '%1' not exists File '%1' not exists Unsupported document format: %1 Unsupported document format: %1 Reading variations from %1 [%2] Reading variations from %1 [%2] Incorrect track object in %1 Incorrect track object in %1 U2::LocalWorkflow::ReadVariationWorker Read Variations Read Variations Reads variations from files and produces variations tracks. All variation file formats supported by UGENE are allowed as input to this element. Reads variations from files and produces variations tracks. All variation file formats supported by UGENE are allowed as input to this element. Variation track Variation track Split Alleles Split Alleles If the file contains variations with multiple alleles (chr1 100 C G,A), No split mode sends them "as is" to the output, while Split splits them into two variations (chr1 100 C G and chr1 100 C A). If the file contains variations with multiple alleles (chr1 100 C G,A), No split mode sends them "as is" to the output, while Split splits them into two variations (chr1 100 C G and chr1 100 C A). Split Split No split No split Reads variations from %1. Reads variations from %1. U2::LocalWorkflow::RemoteDBFetcherPrompter unset unset U2::LocalWorkflow::RemoteDBFetcherWorker sequences identified with sequences identified with sequence identified with sequence identified with sequences identified with resource IDs that will be read from files sequences identified with resource IDs that will be read from files sequences identified with resource IDs that will be read from file sequences identified with resource IDs that will be read from file Save result to %1 folder. Save result to %1 folder. Reads %1 %2 from %3 remote database. %4 Reads %1 %2 from %3 remote database. %4 Cannot create folder '%1' Cannot create folder '%1' failed to load item '%1' from '%2' DB : %3 failed to load item '%1' from '%2' DB : %3 Read from Remote Database Read from Remote Database Reads sequences and annotations if any from a remote database. Reads sequences and annotations if any from a remote database. Sequence Sequence Database Database The database to read from. The database to read from. Read resource ID(s) from source Read resource ID(s) from source The source to read resource IDs from: the list or a local file. The source to read resource IDs from: the list or a local file. File with resource IDs File with resource IDs A file with a list of resource ID`s in the database (one per line). A file with a list of resource ID`s in the database (one per line). Resource ID(s) Resource ID(s) Semicolon-separated list of resource ID`s in the database. Semicolon-separated list of resource ID`s in the database. Save file to folder Save file to folder The folder to store sequence files loaded from a database. The folder to store sequence files loaded from a database. NCBI database NCBI database U2::LocalWorkflow::RenameChomosomeInVariationPrompter unset unset %1 %1 For each variation from %1 replace chromosome prefix%2 %3 with %4 prefix. For each variation from %1 replace chromosome prefix%2 %3 with %4 prefix. U2::LocalWorkflow::RenameChomosomeInVariationWorker An unexpected task type An unexpected task type Source file URL is empty Source file URL is empty Change Chromosome Notation for VCF Change Chromosome Notation for VCF Changes chromosome notation for each variant from the input VCF or other variation files. Changes chromosome notation for each variant from the input VCF or other variation files. Input file URL Input file URL Input files(s) with variations, usually in VCF format. Input files(s) with variations, usually in VCF format. Output file URL Output file URL Output file(s) with annotated variations. Output file(s) with annotated variations. Produced URL Produced URL Location of a corresponding produced file. Location of a corresponding produced file. Replace prefixes Replace prefixes Input the list of chromosome prefixes that you would like to replace, for example "NC_000". Separate different prefixes by semicolons. Input the list of chromosome prefixes that you would like to replace, for example "NC_000". Separate different prefixes by semicolons. Replace by Replace by Input the prefix that should be set instead, for example "chr". Input the prefix that should be set instead, for example "chr". U2::LocalWorkflow::RmdupBamPrompter unset unset %1 %1 Remove PCR duplicates of BAM files from %1 with SAMTools rmdup. Remove PCR duplicates of BAM files from %1 with SAMTools rmdup. U2::LocalWorkflow::RmdupBamWorker Remove Duplicates in BAM Files Remove Duplicates in BAM Files Remove PCR duplicates of BAM files using SAMTools rmdup. Remove PCR duplicates of BAM files using SAMTools rmdup. BAM File BAM File Set of BAM files to rmdup Set of BAM files to rmdup Cleaned BAM File Cleaned BAM File Cleaned BAM file Cleaned BAM file Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output BAM name Output BAM name A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .nodup.bam extention. A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .nodup.bam extention. Remove for single-end reads Remove for single-end reads Remove duplicate for single-end reads. By default, the command works for paired-end reads only (-s). Remove duplicate for single-end reads. By default, the command works for paired-end reads only (-s). Treat as single-end Treat as single-end Treat paired-end reads and single-end reads (-S). Treat paired-end reads and single-end reads (-S). Custom Custom Input file Input file Workflow Workflow Unknown file format: Unknown file format: U2::LocalWorkflow::SamtoolsRmdupTask Samtool rmdup for %1 Samtool rmdup for %1 No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: Can not run %1 tool Can not run %1 tool %1 tool exited with code %2 %1 tool exited with code %2 Tool %1 finished successfully Tool %1 finished successfully U2::LocalWorkflow::SamtoolsSortTask No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: U2::LocalWorkflow::SamtoolsViewFilterTask Samtool view (filter) for %1 Samtool view (filter) for %1 No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: Can not run %1 tool Can not run %1 tool %1 tool exited with code %2 %1 tool exited with code %2 Tool %1 finished successfully Tool %1 finished successfully U2::LocalWorkflow::SchemaWorker Some workflow is in this element. Some workflow is in this element. U2::LocalWorkflow::ScriptWorker For input port was set empty data type For input port was set empty data type For output port was set empty data type For output port was set empty data type Input data Input data Output data Output data no script text no script text U2::LocalWorkflow::ScriptWorkerTask Error in line Error in line Script worker task Script worker task U2::LocalWorkflow::SequenceQualityTrimPrompter unset unset from %1 from %1 Trim input sequence %1 from %2, using the quality threshold. U2::LocalWorkflow::SequenceQualityTrimWorker There is no sequence object in the message An unexpected task type An unexpected task type Sequence was filtered out by quality Sequence Quality Trimmer The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Input Sequence Set of sequences to trim by quality Output Sequence Trimmed sequences Trimming quality threshold Quality threshold Quality threshold Quality threshold for trimming. Quality threshold for trimming. Min length Min Length Min Length Too short reads are discarded by the filter. Too short reads are discarded by the filter. Trim both ends Trim both ends Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS U2::LocalWorkflow::SequenceSplitPromter unset unset from %1 from %1 %1 it if annotation marks translated subsequence, %1 it if annotation marks translated subsequence, translate translate make it %1 if annotation is located on complement strand, make it %1 if annotation is located on complement strand, expand it to left with %1, expand it to left with %1, expand it to right with %1 expand it to right with %1 Extract each annotated sequence region %5 %2 %3%4 Extract each annotated sequence region %5 %2 %3%4 U2::LocalWorkflow::SequenceSplitWorker No sequence provided to split worker No sequence provided to split worker Nothing to extract. Sequence '%1' has no annotations. Nothing to extract. Sequence '%1' has no annotations. Nothing to extract: no sequence region match the constraints Nothing to extract: no sequence region match the constraints Input sequence Input sequence A sequence which will be split into annotated regions. A sequence which will be split into annotated regions. Annotated regions Annotated regions Resulted subsequences, translated and complemented according to corresponding annotations. Resulted subsequences, translated and complemented according to corresponding annotations. Translate Translate Translate the annotated regions. Translate the annotated regions. Complement Complement Complement the annotated regions if the corresponding annotation is located on complement strand. Complement the annotated regions if the corresponding annotation is located on complement strand. Split joined Split joined Split joined annotations to single region annotations. Split joined annotations to single region annotations. Extend left Extend left Extend the resulted regions to left. Extend the resulted regions to left. Extend right Extend right Extend the resulted regions to right. Extend the resulted regions to right. Gap length Gap length Insert gap of specified length between merged locations of annotation. Insert gap of specified length between merged locations of annotation. Get Sequences by Annotations Get Sequences by Annotations Creates sequences from annotated regions of input sequence. Creates sequences from annotated regions of input sequence. U2::LocalWorkflow::SequencesToMSAPromter Creates multiple sequence alignment from supplied sequences. Creates multiple sequence alignment from supplied sequences. U2::LocalWorkflow::SequencesToMSAWorker Input sequences Input sequences Sequences to be joined into alignment. Sequences to be joined into alignment. Result alignment Result alignment Alignment created from the given sequences. Alignment created from the given sequences. Join Sequences into Alignment Join Sequences into Alignment Creates multiple sequence alignment from sequences. Creates multiple sequence alignment from sequences. U2::LocalWorkflow::SortBamPrompter unset unset from %1 from %1 Sort BAM file %1 with SAMTools sort. Sort BAM file %1 with SAMTools sort. U2::LocalWorkflow::SortBamWorker Sort BAM Files Sort BAM Files Sort BAM Files using SAMTools Sort. Sort BAM Files using SAMTools Sort. BAM File BAM File Set of BAM files to sort Set of BAM files to sort Sorted BAM File Sorted BAM File Sorted BAM file Sorted BAM file Output folder Output folder Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. Custom folder Custom folder Select the custom output folder. Select the custom output folder. Output BAM name Output BAM name A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .sorted.bam extention. A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .sorted.bam extention. Build index Build index Build index for the sorted file with SAMTools index. Build index for the sorted file with SAMTools index. Custom Custom Input file Input file Workflow Workflow Unknown file format: Unknown file format: U2::LocalWorkflow::Text2SequencePrompter unset unset from %1 from %1 sequence with name %1 sequence with name %1 Automatically detect sequence alphabet Automatically detect sequence alphabet Set sequence alphabet to %1 Set sequence alphabet to %1 skipped skipped replaced with symbol replaced with symbol Convert input text%1 to %2. %3. Unknown symbols are %4. Convert input text%1 to %2. %3. Unknown symbols are %4. U2::LocalWorkflow::Text2SequenceWorker Sequence name not set Sequence name not set skip flag should be set or replace character defined skip flag should be set or replace character defined Alphabet cannot be automatically detected Alphabet cannot be automatically detected Alphabet '%1' cannot be found Alphabet '%1' cannot be found Input text Input text A text which will be converted to sequence A text which will be converted to sequence Output sequence Output sequence Converted sequence Converted sequence Sequence name Sequence name Result sequence name. Result sequence name. Select one of the listed alphabets or choose auto to auto-detect. Select one of the listed alphabets or choose auto to auto-detect. Do not include symbols that are not contained in alphabet. Do not include symbols that are not contained in alphabet. Replace unknown symbols with given character. Replace unknown symbols with given character. Sequence alphabet Sequence alphabet Skip unknown symbols Skip unknown symbols Replace unknown symbols with Replace unknown symbols with Convert Text to Sequence Convert Text to Sequence Converts input text to sequence. Converts input text to sequence. U2::LocalWorkflow::TextReader Can't load the object %1 from the database %2 Can't load the object %1 from the database %2 Can't load file %1 Can't load file %1 Can't load file %1. %2 Can't load file %1. %2 U2::LocalWorkflow::WriteAnnotationsPrompter unset unset default file default file Save all annotations from %1 to %2 Save all annotations from %1 to %2 in %1 format. in %1 format. in the in the database. database. U2::LocalWorkflow::WriteAnnotationsWorker Unrecognized formatId: '%1' Unrecognized formatId: '%1' Invalid shared DB URL Invalid shared DB URL Invalid path in shared DB Invalid path in shared DB Unrecognized data storage: '%1' Unrecognized data storage: '%1' Unspecified URL to write Unspecified URL to write Unrecognized data storage Unrecognized data storage Annotations name not specified. Default value used: '%1' Annotations name not specified. Default value used: '%1' Nothing to write Nothing to write Input annotations Input annotations Input annotations which will be written to output file Input annotations which will be written to output file Merge annotation tables If true all annotation tables from dataset will be merged into one. The value of Annotation table name parameter will be used as the name of result annotation table. Annotation table name The name for the result annotation table that contains merged annotation data from file or dataset. If true all annotation tables from dataset will be merged into one annotation object. The value of Annotation object name parameter will be used as the name of result annotation object. Annotations name Annotations name Name of the saved annotations. This option is only available for document formats that support saving of annotations names. Name of the saved annotations. This option is only available for document formats that support saving of annotations names. Annotation object name Annotation object name Name of the saved annotation object. Name of the saved annotation object. CSV separator CSV separator String which separates values in CSV files. String which separates values in CSV files. Write sequence names Write sequence names Add names of sequences into CSV file. Add names of sequences into CSV file. Write Annotations Write Annotations Writes all supplied annotations to file(s) in selected format. Writes all supplied annotations to file(s) in selected format. U2::LocalWorkflow::WriteBAMWorker Assembly Assembly Write Assembly Write Assembly Writes all supplied assemblies to file(s) in selected format. Writes all supplied assemblies to file(s) in selected format. Location Location Location for writing data Location for writing data Save all assemblies from %1 to %2. Save all assemblies from %1 to %2. U2::LocalWorkflow::WriteVariationWorker Write variations: internal error Write variations: internal error Variation track Variation track Write Variations Write Variations Writes all supplied variations to file(s) in selected format. Writes all supplied variations to file(s) in selected format. Location Location Location for writing data Location for writing data Save all variations from %1 to %2. Save all variations from %1 to %2. U2::NameFilterLayout Type to filter by name... Type to filter by name... Name filter: Name filter: Esc Esc U2::ProduceSchemaImageLinkTask Save workflow image Save workflow image Cannot find workflow: %1 Cannot find workflow: %1 U2::RenameChromosomeInVariationFileTask Rename chomosome name file with variations Rename chomosome name file with variations File doesn't contains variant tracks File doesn't contains variant tracks File format is not recognized (%1) File format is not recognized (%1) U2::RenameChromosomeInVariationTask Rename task Rename task U2::SampleActionsManager This task requires the following plugins: %1. Add them and try again, please. This task requires the following plugins: %1. Add them and try again, please. U2::SaveWorkflowSceneTask Save workflow scene task Save workflow scene task U2::SequenceQualityTrimTask Trim sequence by quality The sequence '%1' was filtered out by quality The trimming was skipped for the sequences without quality information. U2::StartupDialog You have no write access to the folder. Please choose another one. You have no write access to the folder. Please choose another one. U2::Workflow::CoreLib Location Location Location for writing data Location for writing data Write FASTA Write FASTA Writes all supplied sequences to file(s) in FASTA format. Writes all supplied sequences to file(s) in FASTA format. Sequence Sequence A sequence along with FASTA header line. A sequence along with FASTA header line. Read Plain Text Read Plain Text Reads text from local or remote files. All text file formats supported by UGENE are allowed as input to this element. Reads text from local or remote files. All text file formats supported by UGENE are allowed as input to this element. Plain text Plain text Reads text from %1. Reads text from %1. Write Plain Text Write Plain Text Write strings to a file. Write strings to a file. Save text from %1 to %2. Save text from %1 to %2. Another worker with this name is already registered: %1 Another worker with this name is already registered: %1 The actor '%1' has been already registered The actor '%1' has been already registered Multiple sequence alignment Multiple sequence alignment Save all MSAs from %1 to %2. Save all MSAs from %1 to %2. Write Alignment Write Alignment Writes all supplied alignments to file(s) in selected format. Writes all supplied alignments to file(s) in selected format. Write Sequence Write Sequence Writes all supplied sequences to file(s) in selected format. Writes all supplied sequences to file(s) in selected format. Save all sequences from %1 to %2. Save all sequences from %1 to %2. Read Sequence Read Sequence Reads sequences and annotations if any from local or remote files. All sequence file formats supported by UGENE (e.g. GenBank, FASTA) are allowed as input to this element. Reads sequences and annotations if any from local or remote files. All sequence file formats supported by UGENE (e.g. GenBank, FASTA) are allowed as input to this element. A sequence of any type (nucleotide, protein). A sequence of any type (nucleotide, protein). Reads sequence(s) from %1. Reads sequence(s) from %1. Read Alignment Read Alignment Reads multiple sequence alignments (MSAs) from local or remote files. All MSA file formats supported by UGENE are allowed as input to this element.Besides recognized alignment formats, it supports aligning from a set of sequences in a corresponding file (e.g. FASTA or Genbank). Reads multiple sequence alignments (MSAs) from local or remote files. All MSA file formats supported by UGENE are allowed as input to this element.Besides recognized alignment formats, it supports aligning from a set of sequences in a corresponding file (e.g. FASTA or Genbank). Reads MSA(s) from %1. Reads MSA(s) from %1. U2::Workflow::GalaxyConfigConfigurationDialogImpl Set UGENE folder Set UGENE folder Set Galaxy folder Set Galaxy folder Set destination folder Set destination folder U2::Workflow::PortAliasesConfigurationDialog Cancel Cancel OK OK Input Input Output Output Workflow Designer Workflow Designer There is a port with some aliased slots but without alias name: %1 There is a port with some aliased slots but without alias name: %1 Slot aliases of one port must be different! Slot aliases of one port must be different! Port aliases must be different! Rename one of ports: %1 or %2 Port aliases must be different! Rename one of ports: %1 or %2 U2::Workflow::ReadAssemblyTask Read assembly from %1 Read assembly from %1 File '%1' not exists File '%1' not exists File '%1' does not exist File '%1' does not exist Unsupported document format: %1 Unsupported document format: %1 Can not read assemblies from the file: %1 Can not read assemblies from the file: %1 Reading assembly from %1 [%2] Reading assembly from %1 [%2] No assemblies in the file: %1 No assemblies in the file: %1 Incorrect assembly object in %1 Incorrect assembly object in %1 U2::Workflow::SchemaAliasesConfigurationDialogImpl Cancel Cancel OK OK U2::Workflow::SeqReadPrompter Mode Mode If the file contains more than one sequence, Split mode sends them "as is" to the output, while Merge appends all the sequences and outputs the sole merged sequence. If the file contains more than one sequence, Split mode sends them "as is" to the output, while Merge appends all the sequences and outputs the sole merged sequence. Merging gap Merging gap In Merge mode, the specified number of gaps are inserted between the original sequences. This is helpful, for example, to avoid finding false positives at the merge boundaries. In Merge mode, the specified number of gaps are inserted between the original sequences. This is helpful, for example, to avoid finding false positives at the merge boundaries. Accession filter Accession filter Reports only sequences containing the specified regular expression.Leave it empty to switch off this filter. Use * to mask many symbol and use ? to mask one symbol. Reports only sequences containing the specified regular expression.Leave it empty to switch off this filter. Use * to mask many symbols and ? to mask one symbol. Reports only sequences containing the specified regular expression.Leave it empty to switch off this filter. Use * to mask many symbols and ? to mask one symbol. Sequence count limit Sequence count limit Split mode only.Read only first N sequences from each file. Set 0 value for reading all sequences. Split mode only.Read only first N sequences from each file. Set 0 value for reading all sequences. Split Split Merge Merge U2::Workflow::WriteDocPrompter unset unset in the in the database. database. U2::Workflow::WriteFastaPrompter Writes sequence(s) in %1 format to %2. Writes sequence(s) in %1 format to %2. Writes sequence(s) from %1 in %2 format to %3. Writes sequence(s) from %1 in %2 format to %3. U2::Workflow::WriteGenbankPrompter sequence from %1 sequence from %1 set of annotations from %1 set of annotations from %1 Write sequence(s) in Genbank format to %1. Write sequence(s) in Genbank format to %1. each %1 and %2 each %1 and %2 each each Write %1 in Genbank format, to %2. Write %1 in Genbank format, to %2. U2::WorkflowDesignerPlugin Workflow Designer Workflow Designer Workflow Designer allows to create complex computational workflows. Workflow Designer allows to create complex computational workflows. Runs the specified task. Runs the specified task. Runs the specified task. A path to a user-defined UGENE workflow be used as a task name. Runs the specified task. A path to a user-defined UGENE workflow be used as a task name. <task_name> [<task_parameter>=value ...] <task_name> [<task_parameter>=value ...] Prints the content of the specified slot. Prints the content of the specified slot. Prints the content of the specified slot. The incoming/outcoming content of specified slot is printed to the standart output. Prints the content of the specified slot. The incoming/outcoming content of specified slot is printed to the standart output. <actor_name>.<port_name>.<slot_name> <actor_name>.<port_name>.<slot_name> Creates new Galaxy tool config. Creates new Galaxy tool config. Creates new Galaxy tool config from existing workflow. Paths to UGENE and Galaxy can be set Creates new Galaxy tool config from existing workflow. Paths to UGENE and Galaxy can be set <uwl-file> [--ugene-path=value] [--galaxy-path=value] <uwl-file> [--ugene-path=value] [--galaxy-path=value] Close Designer Close Designer Close Designer canceled Close Designer canceled U2::WorkflowDesignerService Workflow Designer Workflow Designer New workflow New workflow Workflow Designer... Workflow Designer... New workflow... New workflow... Can not open Workflow Designer. Please, try to reload UGENE. Can not open Workflow Designer. Please, try to reload UGENE. Reads quality control and alignment Reads quality control and alignment Reads quality control... Reads quality control... Filter short scaffolds... Raw DNA-Seq data processing Raw DNA-Seq data processing Variant calling Variant calling Variant calling and effects prediction Annotate variants and predict effects Annotate variants and predict effects Raw RNA-Seq data processing Raw RNA-Seq data processing RNA-Seq data analysis RNA-Seq data analysis Extract transcript sequences Extract transcript sequences Raw ChIP-Seq data processing Raw ChIP-Seq data processing ChIP-Seq data analysis ChIP-Seq data analysis ChIP-Seq coverage ChIP-Seq coverage Extract coverage from assemblies Extract coverage from assemblies Extract consensus from assemblies Extract consensus from assemblies Remote NCBI BLAST Remote NCBI BLAST U2::WorkflowDocFormat Workflow Workflow WorkflowDoc is a format used for creating/editing/storing/retrievingworkflow with the text file WorkflowDoc is a format used for creating/editing/storing/retrievingworkflow with the text file Invalid header. %1 expected Invalid header. %1 expected U2::WorkflowEditor Name Name Value Value Script Script Parameters Parameters Element name: Element name: To configure the parameters of the element go to "Parameters" area below. To configure the parameters of the element go to "Parameters" area below. %1 "%2" of task "%3": %4 %5 %1 "%2" of task "%3": %4 %5 Output port Output port Input port Input port You can observe data slots of the port and configure connections if any in the "Parameters" widget suited below. You can observe data slots of the port and configure connections if any in the "Parameters" widget suited below. Input data Input data Output data Output data Select an element to inspect. Select an element to inspect. U2::WorkflowInvestigationWidgetsController Messages from ' Messages from ' ' to ' ' to ' ' ' U2::WorkflowMetaDialog Cancel Cancel OK OK Save workflow to file Save workflow to file U2::WorkflowPaletteElements Can't remove element %1 Can't remove element %1 Expand all Expand all Collapse all Collapse all Edit Edit Remove Remove U2::WorkflowRemoteRunFromCMDLineTask %1 parameter expected, but not set %1 parameter expected, but not set Cannot read remote machine settings from %2 Cannot read remote machine settings from %2 U2::WorkflowRunFromCMDLineBase Workflow run from cmdline Workflow run from cmdline no task to run no task to run Cannot find workflow: %1 Cannot find workflow: %1 alias '%1' not set in workflow alias '%1' not set in workflow actor parameter '%1' not found actor parameter '%1' not found cannot parse value from '%1' cannot parse value from '%1' Incorrect value for '%1', null or default value passed to workflow Incorrect value for '%1', null or default value passed to workflow U2::WorkflowScene Open document(s) Open document(s) Workflow Designer Workflow Designer Unable to open specified documents. Watch log for details. Unable to open specified documents. Watch log for details. Drop an element from the palette here Drop an element from the palette here U2::WorkflowSettingsPageController Workflow Designer Workflow Designer U2::WorkflowTabView Close dashboard Close dashboard Rename Dashboard Rename Dashboard New dashboard name: New dashboard name: Run Run Rename Rename U2::WorkflowUtils UGENE workflow element UGENE workflow element U2::WorkflowView Invalid content: duplicate process %1 Invalid content: duplicate process %1 Invalid content: unknown process type %1 Invalid content: unknown process type %1 Minimal Minimal Extended Extended Workflow Designer Workflow Designer Elements Elements Samples Samples Error list Error list Warning! Warning! Undefined workflow format for %1 Undefined workflow format for %1 file file &Run workflow &Run workflow S&top workflow S&top workflow &Validate workflow &Validate workflow &Estimate workflow &Estimate workflow &Pause workflow &Pause workflow &Next step &Next step Process one &message Process one &message &New workflow... &New workflow... &Save workflow &Save workflow &Save workflow as... &Save workflow as... Show wizard Show wizard &Load workflow &Load workflow Delete Delete Set parameter aliases... Set parameter aliases... Set port and slot aliases... Set port and slot aliases... Create element with script... Create element with script... Edit script of the element... Edit script of the element... Create element with command line tool... Create element with command line tool... Add element with command line tool... Add element with command line tool... Can't load element. Can't load element. Element style Element style Element properties Element properties New workflow New workflow Select all elements Select all elements &Export workflow as image &Export workflow as image Dashboards manager Dashboards manager Create Galaxy tool config... Create Galaxy tool config... &Copy &Copy Cu&t Cu&t &Paste &Paste Hide scripting options Hide scripting options Show scripting options Show scripting options Unlock Scene Unlock Scene Scripting mode Scripting mode Add element Add element Import workflow to element... Import workflow to element... Edit configuration... Edit configuration... Can't remove element %1 Can't remove element %1 Empty workflow! Empty workflow! Nothing to run: empty workflow Nothing to run: empty workflow Workflow cannot be executed Workflow cannot be executed Please fix issues listed in the error list (located under workflow). Please fix issues listed in the error list (located under workflow). Workflow is valid. Workflow is valid. Well done! Well done! There are non-critical warnings. There are non-critical warnings. Workflow is valid Workflow is valid Bad input! Bad input! Aliases for workflow parameters should be different! Aliases for workflow parameters should be different! The workflow contains a wizard. Sorry, but current version of UGENE doesn't support of wizards in the includes. The workflow contains a wizard. Sorry, but current version of UGENE doesn't support of wizards in the includes. Error Error Workflow does not contain any parameter aliases Workflow does not contain any parameter aliases Internal error! Internal error! Can not create Galaxy config Can not create Galaxy config Drag the palette element to the scene or just click on the scene to add the element. Drag the palette element to the scene or just click on the scene to add the element. File is not found: %1 File is not found: %1 Show dashboard Show dashboard Show workflow Show workflow Open workflow file Open workflow file Workflow Designer - %1 Workflow Designer - %1 The workflow has been modified. Do you want to save changes? The workflow has been modified. Do you want to save changes? U2::WorkflowViewFactory Open multiple views Open multiple views Workflow Designer Workflow Designer WorkflowEditorWidget Form Form Property Editor Property Editor TextLabel TextLabel Parameters Parameters Input data Input data Output data Output data WorkflowMetaDialog Workflow Properties Workflow Properties Location Location ... ... Name Name Comment Comment WorkflowSettingsWidget Resource settings Resource settings Scene appearance Scene appearance Element style Element style Element font Element font Element background color Element background color Enable debugger Enable debugger Directories Use directory for output files Directory for custom elements with scripts Directory for custom elements with command line tools Directory for included schema elements Use folder for output files Use folder for output files Folder for custom elements with scripts Folder for custom elements with scripts Folder for custom elements with command line tools Folder for custom elements with command line tools Folder for included schema elements Folder for included schema elements Snap to grid Snap to grid Show grid Show grid Runtime settings Runtime settings Track running progress Track running progress Folders Folders WorkflowUtils UGENE workflow element UGENE workflow element WriteDocPrompter default file default file