ChooseItemDialog Choose task type Выбор типа задачи Add a task of the following type: Возможно создать объект для следующих задач: CreateExternalProcessWorkerDialog Create Element with Command Line Tool Создать элемент при помощи командной строки Element description Описание элемента Name Имя Description Описание <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Name and description for new workflow element. Status: %1</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> </body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Input and output data for external tool. Name is a command line parameter for input/output data in external tool. Set data type and format in which external tool reads/writes input/output data. You also can set description for workflow designer. Each input data will be represented as port in workflow designer. Each output data will be represented as slot of single slot.</body></html> Input data Входные данные Add input Добавить входные данные Delete Удалить Output data Выходные данные Add output Добавить выходные данные <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Another parameters for external tool. You must set name for parameter and its type. You also can set description for workflow designer. Each parameter will be represented as parameter of workflow element.</body></html> Parameters Параметры Add attribute Добавить атрибут <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Execution string and element's description. To substitute input, output data or parameter, use it's name with prefix $ in execution string. You can set parameterized description for new element(description that appears not in property editor but on element itself). In parameterized description you also can use parameters substitution with prefix $. If file paths in the execution string contain spaces, they must be enclosed with single quotes.</body></html> Command line template Заготовка для командной строки Execution string Строка выполнения Parameterized description Описание CreateScriptBlockDialog Create Element with Script Создать элемент при помощи скрипта Name Имя ScriptBlock Скриптовый блок Description Описание <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Evaluates user's script</body></html> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <html><head><meta name="qrichtext" content="1" /><style type="text/css"> p, li { white-space: pre-wrap; } </style></head><body style=" font-family:'MS Shell Dlg 2'; font-size:8.25pt; font-weight:400; font-style:normal;"> Оценивает скрипт пользователя </body></html> Input Port Входной порт Add input slot Добавить слот Delete input slot Удалить слот Output Port Выходной порт Add output slot Добавить слот Delete output slot Удалить слот Attributes Атрибуты Add Attribute Добавить атрибут Delete Attribute Удалить атрибут Error Ошибка Error occured while saving new actor. Can't write to current directory. Choose another directory for store user's elements Error occured while saving new actor. Can't write to current folder. Choose another folder for store user's elements Произошла ошибка во время сохранения нового актера. Невозможно записать в текущей папке. Выберите другую папку ... ... DashboardsManagerDialog Dashboards Manager Управление панелями Check dashboards to show: Выбрать панели для отображения: Check selected Отметить выделенные Uncheck selected Снять метки с выделенных Remove selected Удалить выделенные Select all Выделить все GalaxyConfigConfigurationDialog Create Galaxy config Создать конфигурацию с Galaxy Cancel Отмена ... ... UGENE directory Destination directory Galaxy directory UGENE folder Папка UGENE Destination folder Расположение папки Galaxy folder Папка Galaxy Create Создать ImportSchemaDialog Import Workflow to Element Импортировать схему в элемент Input new element name: Имя нового элемента: PaletteWidget Form Форма PortAliasesConfigurationDialog Configure Port and Slot Aliases Конфигурация интерфейса командной строки для портов и слотов Workflow ports Порты схемы Slot Слот Alias Алиас Port alias Алиас порта Port type: Тип порта: Port alias: Алиас порта: Port description: Описание порта: QObject Removing Dashboards Удаление панелей The following dashboards are about to be deleted: Следующие панели будут удалены: The following dashboard is about to be deleted: Следующие панели будут удалены: Empty text slot Слот типа текст пуст Empty sequence slot Слот типа последовательность пуст Error with sequence object Ошибка с объектом типа последовательность Empty annotations slot Слот типа аннотация пуст Empty alignment slot Слот типа выравнивание пуст Error with alignment object Ошибка с объектом типа выравнивание Unknown document format: %1 Неизвестный формат документа: %1 No target objects in the file: %1 Требуемых объектов в файле не найдено: %1 Error with annotations object Ошибка с объектом типа аннотация Pattern(s) Паттерн(ы) Semicolon-separated list of patterns to search for. Список паттернов для поиска. Pattern file Файл с паттерном Load pattern from file in any sequence format or in newline-delimited format. Загружает паттерн из файла в формате последовательности или в формате строк с разделителями. Patterns are not set. Set the '%1' or '%2' parameter or bind the input text slot Паттерн(ы) не выбраны. Установите '%1' или '%2' параметр parameter или свяжите со входным слотом типа текст The minimum datasets count is %1. The current count is %2 Минимальное количество датасетов %1. Текущее количество %2 The maximum datasets count is %1. The current count is %2 Максимальное количество датасетов %1. Текущее количество %2 Input '%1' slot is not supplied Входной '%1' слот не подан The format %1 does not support annotations Формат %1 не поддерживает аннотации Breakpoints Точки остановки Element style Стиль % % You opened obsolete workflow in XML format. It is strongly recommended to clear working space and create workflow from scratch. Sorry! This workflow is obsolete and cannot be opened. Scripting mode Скриптинг Can not create the folder: Невозможно создать папку: The file '%1' already exists Файл '%1' уже существует Can not copy the file here: Невозможно скопировать файл: Run workflow Запустить схему Extract Consensus from Assembly Извлечение консенсуса из сборки Extract the consensus sequence from the incoming assembly. Извлечь консенсусную последовательность из входной сборки. Algorithm Алгоритм The algorithm of consensus extracting. Алгоритм извлечения консенсусной последовательности. Keep gaps Оставить пробелы Set this parameter if the result consensus must keep the gaps. Установить этот параметр если консенсус должен содержать пробелы. Messages in requested queue include info of the '%1' data type that is currently unsupported for view. No intermediate data will be displayed Messages in requested queue include info of the '%1' data type that is currently unsupported for view. No intermediate data will be displayed coverage покрытие bases count число оснований Save annotations Сохранить аннотации RemoteDBFetcherWorker List of IDs Список идентификаторов File with IDs Файл с идентификаторами SchemaAliasesConfigurationDialog Configure Parameter Aliases Конфигурация алиасов параметров Workflow elements Элементы Parameter Параметр Alias Алиас Description Описание StartupDialog Choose Output Folder Выбор папки для сохранения выходных данных Output Folder Выходная папка Choose Output Directory Output Directory Note: you can change this option in the UGENE Application Settings (Settings > Preferences > Workflow Designer) Замечание: вы можете изменить эти настройки в общих настройках UGENE (Настройки > Установки > Дизайнер вычислительных схем) U2::ActorCfgModel N/A N/A U2::BreakpointManagerView &Break at element... &Точка остановки на элементе... Delete &all breakpoints Удалить &все точки остановки &Delete &Удалить Delete the selected breakpoints Удалить выделенные точки остановки &Enable or disable all breakpoints &Включить или выключить все точки останвоки H&ighlight selected item &Подсветить выделенный элемент &Hit Count... &Число попаданий... Edit &labels... Редактировать &название... &Condition... &Условие... U2::CfgExternalToolModel Name for command line parameter Имя параметра в командной строке Type Тип Read as Прочитать как Write as Записать как Description Описание String value Text file Output file url U2::CfgExternalToolModelAttributes Name Имя Type Тип Description Описание U2::ChooseItemDialog OK OK Cancel Отмена U2::CreateExternalProcessDialog Warning Предупреждение You have changed the structure of the element (name, slots, attributes' names and types). All elements on the scene would be removed. Do you really want to change it? You could also reset the dialog to the initial state. Вы изменили структуру элемента (имя, слоты, имена или типы аттрибутов'). Все элементы на сцене будут удалены. Вы действительно хотите сделать это? Также вы можете вернуть диалог к изначальному состоянию. Create Element Создание элемента Please set the input/output data. Установите входные и выходные данные. Please set the command line to run external tool. Установите параметры командной строки чтобы запустить внутренний инструмент. Please set the name for the new element. Установите имя для нового элемента. Invalid symbols in the element name. Некорректные символы в имени элемента. Element with this name already exists. Элемент с таким именем уже существует. For one or more parameter name was not set. Для одного или более парваметров не задано имя. Invalid symbols in a name. Некорректные символы в имени. The same name of element parameters was found Параметр с таким именем уже существует You don't use parameter %1 in template string. Continue? Вы не можете использовать параметр %1 в шаблонной строке. Продолжить? Continue Продолжить Abort Вернуться Spaces in the element name. Пробелы в имени элемента. It is the correct name Это корректное имя U2::CreateScriptElementDialog Name Имя Type Тип OK OK Cancel Отмена error ошибка Two identical types for input port Два одинаковых типа для входного порта two identical types for input port два одинаковых типа для входного порта Two identical types for output port Два одинаковых типа для выходного порта two identical types for output port два одинаковых типа для входного порта Name for some attributes is empty Имена для некоторых аттрибутов пусты Two attributes with name %1 Два атрибута с именем %1 Name for block is empty Имя для блока пусто Actor with this name already registered Указатель с этим именем уже зарегистрирован Description for block is empty Описание для блока пусто Can't save user's workflow element Невозможно сохранить элемент U2::DashboardManagerHelper No Dashboards Found Не найдено панелей You do not have any dashboards yet. You need to run some workflow to use Dashboards Manager. У вас еще нет ни одной панели. Вам необходимо запустить какую-нибудь схему, чтобы использовать менеджер панелей. U2::DashboardsManagerDialog OK OK Name Имя Folder Папка Confirm Подтвердить Cancel Отмена U2::EstimationDialog Workflow Estimation Оценка времени исполнения схемы U2::ExtendedProcStyle Auto-resize to text Динамический размер U2::GalaxyConfigTask Create Galaxy config from existing workflow Создать конфинурацию Galaxy с внутренней схемой U2::ImportSchemaDialog Error Ошибка Element name is empty Имя элемента пусто Element name contains spaces Имя элемента содержит пробелы Element name contains dots Имя элемента содержит точки Element name contains @ Имя элемента содержит @ An element with this name already exists Элемент с таким именем уже существует U2::ItemViewStyle Background color Цвет фона Font Шрифт U2::LoadSamplesTask Load workflow samples Загрузка примеров Sample dir does not exist: %1 Папка с примерами не найдена: %1 Failed to load sample: %1 Не удалось загрузить пример %1 U2::LoadWorkflowSceneTask Load workflow scene Загрузить схему Undefined format: plain text or xml expected Неизвестный формат: содержится тест или xml Error while parsing file: %1 Ошибка во время конвертации файла: %1 U2::LocalWorkflow::AlignToReferencePrompter Input sequence Входная последовательность Input sequence. Входная последовательность. Aligned data Выровненные данные Aligned data. Выровненные данные. Reference URL Путь до референса A URL to the file with a reference sequence. Путь до файла с референсной последовательностью. unset не указан Aligns each sequence from %1 to the reference sequence from %2. Выравнивает каждую последовательность из %1 на референсчную последовательность из %2. U2::LocalWorkflow::AlignToReferenceTask Align to reference Выравнивание на референс U2::LocalWorkflow::AlignToReferenceWorker Align to Reference Выравнивание на референс Align input sequences (e.g. Sanger reads) to the reference sequence. Выровнять входные последовательности на референсную последовательность. Can not read the reference file: Can not read the reference file: Can't read the file: Can't read the file: No reference sequence in the file: No reference sequence in the file: More than one sequence in the reference file: More than one sequence in the reference file: U2::LocalWorkflow::Alignment2SequencePrompter unset не указан from %1 из %1 Split alignment%1 into sequences. Разделить выравнивание%1 на последовательности. U2::LocalWorkflow::Alignment2SequenceWorker empty input alignment пустое входное выравнивание Input alignment Входное выравнивание A alignment which will be split into sequences Выравнивание, которое будет разделено на последовательности Output sequences Выходные последовательности Converted sequences Сконвертированные последовательности Split Alignment into Sequences Разделение выравнивания на последовательности Splits input alignment into sequences Разделить входное выравнивание на последовательности U2::LocalWorkflow::AminoTranslationPrompter unset не указан from %1 из %1 U2::LocalWorkflow::AminoTranslationWorker Input Data Входная последовательность An input sequence to translate in amino. Транслировать входную последовательность в амино. Amino sequence Амино последовательность Sequence has been translated. Последовательности транслированы. Translate from Транслировать из What position would sequence translated from : first, second, third or from all positions. Позиция, с которой будет транслирована последовательность: с первой, второй, третьей или все позиции. Auto selected genetic code Автоматическая установка генетического кода Set if genetic code will be selected automatically. Установить если генетический код будет выбран автоматически. Amino Translation Трансляция Translate sequence into it's amino translation . Output a sequence. Транслировать последовательность в аминокислотную последовательность. Genetic code Генетический код Which genetic code should be used for translating the input nucleotide sequence. Выбор генетического кода, который будет использован для трансляции входной нуклеотидной последовательности. Error on getting %1 sequence: Error on getting %1 sequence: U2::LocalWorkflow::AssemblyToSequencesPrompter unset не указан %1 %1 Split %1 assemblies into sequences(reads) and puts them to the output. Разделить %1 сборку на последовательности(риды). U2::LocalWorkflow::AssemblyToSequencesTask Split Assembly into Sequences Разделение сборки на последовательности U2::LocalWorkflow::AssemblyToSequencesWorker Split Assembly into Sequences Разделение сборки на последовательности Splits assembly into sequences(reads). Разделяет сборку на поледовательности(риды). U2::LocalWorkflow::BaseDocWriter Document format not set Формат документа не задан Invalid database reference Invalid database reference Empty destination path supplied Empty destination path supplied Unexpected data storage attribute value Unexpected data storage attribute value Unspecified URL to write %1 Не задан адрес для записи %1 Can not create folder: %1 Невозможно создать папку: %1 Can not open a file for writing: %1 Невозможно открыть файл для записи: %1 No data to write Нет данных для записи Nothing to write Нет данных для записи Unable to fetch data from a message Unable to fetch data from a message Save objects to a shared database Save objects to a shared database Writing to %1 [%2] Запись %1 [формат %2] Save documents Сохранение документов U2::LocalWorkflow::BaseWriteAssemblyWorker Assembly writer: NULL assembly object Запись сборки: нет сборки Build index (BAM only) Построение индекса (применимо только к файлам BAM) Build BAM index for the target BAM file. The file .bai will be created in the same folder. построение индекса для BAM-файла. Файл с расширением .bai будет создан в той же папке. U2::LocalWorkflow::CASAVAFilterPrompter unset не указан %1 %1 Filters FASTQ reads from %1 generated by CASAVA 1.8. Фильтрует FASTQ риды из %1 сгенерированные CASAVA 1.8. U2::LocalWorkflow::CASAVAFilterWorker CASAVA FASTQ Filter Фильтр CASAVA FASTQ Reads in FASTQ file produced by CASAVA 1.8 contain 'N' or 'Y' as a part of an idetifier. 'Y' if a read if filtered, 'N' if the read if the read is not filtered. The workflow cleans up the filtered reads. For example: @HWI-ST880:181:D1WRUACXX:8:1102:4905:2125 1:N:0:TAAGGG CTTACATAACTACTGACCATGCTCTCTCTTGTCTGTCTCTTATACACATCT + 111442222322324232AAFFHIJJJJJJIHIIF111CGGFHIG???FGB @HWI-ST880:181:D1WRUACXX:8:1102:7303:2101 1:Y:0:TAAGGG TCCTTACTGTCTGAGCAATGGGATTCCATCTTTTACGATCTAGACATGGCT + 11++4222322<CEE2<:3<3333333<A<CAFE:1?C??::C?00?BD90. Риды в формате FASTQ, являющиеся результатом работы CASAVA 1.8 содержат 'N' или 'Y' как часть идентификатораr. 'Y' если рид отфильтрован, 'N' если не отфильтрован. Схема очищает отфильтрованные риды. Например: @HWI-ST880:181:D1WRUACXX:8:1102:4905:2125 1:N:0:TAAGGG CTTACATAACTACTGACCATGCTCTCTCTTGTCTGTCTCTTATACACATCT + 111442222322324232AAFFHIJJJJJJIHIIF111CGGFHIG???FGB @HWI-ST880:181:D1WRUACXX:8:1102:7303:2101 1:Y:0:TAAGGG TCCTTACTGTCTGAGCAATGGGATTCCATCTTTTACGATCTAGACATGGCT + 11++4222322<CEE2<:3<3333333<A<CAFE:1?C??::C?00?BD90. Input File Входной файл Set of FASTQ reads files Набор файлов с FASTQ ридами Output File Выходной файл Output FASTQ files Выхордные FASTQ файлы Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output file name Имя выходного файла A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Имя выходного файла. Custom Частная Input file Входной файл Workflow Схема U2::LocalWorkflow::CDSearchPrompter unset не указан from %1 из %1 For sequence %1 find conserved domains in database %2. Для последовательности %1 найти консервативные области в базе данных %2. U2::LocalWorkflow::CDSearchWorker Input sequence Входная последовательность The sequence to search the annotations for Последовательность для поиска аннотаций Annotations Аннотации Found annotations Найденные аннотации Database База данных Currently, CD Search is offered with the following search databases: <ul><li>CDD - this is a superset including <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_NCBI_curated">NCBI-curated domains</a> and <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_external">data imported</a> from Pfam, SMART, COG, PRK, and TIGRFAM.</li><li>Pfam - a mirror of a recent Pfam-A database of curated seed alignments. Pfam version numbers do change with incremental updates. As with SMART, families describing very short motifs or peptides may be missing from the mirror. An HMM-based search engine is offered on the <a href="http://pfam.sanger.ac.uk/">Pfam</a> site.</li><li>SMART - a mirror of a recent SMART set of domain alignments. Note that some SMART families may be missing from the mirror due to update delays or because they describe very short conserved peptides and/or motifs, which would be difficult to detect using the CD-Search service. You may want to try the HMM-based search service offered on the <a href="http://smart.embl-heidelberg.de">SMART</a> site. Note also that some SMART domains are not mirrored in CD because they represent "superfamilies" encompassing several individual, but related, domains; the corresponding seed alignments may not be available from the source database in these cases. Note also that SMART version numbers do not change with incremental updates of the source database (and the mirrored CD-Search database).</li> <li>TIGRFAM - a mirror of a recent TIGRFAM set of domain alignments. An HMM-based search engine is offered on the <a href="http://www.jcvi.org/cms/research/projects/tigrfams/overview/">TIGRFAM</a> site.</li><li>COG - a mirror of the current COG database of orthologous protein families focusing on prokaryotes. Seed alignments have been generated by an automated process. An alternative search engine, "Cognitor", which runs protein-BLAST against a database of COG-assigned sequences, is offered on the <a href="http://www.ncbi.nlm.nih.gov/COG">COG</a> site.</li><li>KOG - a eukaryotic counterpart to the COG database. KOGs are not included in the CDD superset, but are searchable as a separate data set.</li></ul> More information about each database is provided in the section on <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource">Where does CDD content come from?</a>. Предлагается CD-поиск со следующими базами данных: <ul><li>CDD - этот набор включает <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_NCBI_curated">NCBI-curated domains</a> и <a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource_external">data imported</a> из Pfam, SMART, COG, PRK, и TIGRFAM.</li><li>Pfam - зеркало Pfam-A базы данных. Версия Pfam изменится с выходом обновлений. Как и SMART, семейства описывающие очень короткие мотивы или пептиды может отсутствовать на зеркале. HMM поиск предложен на <a href="http://pfam.sanger.ac.uk/">Pfam</a> сайте.</li><li>SMART - зеркало SMART наборов областей выравниваний. Учитывайте, что некоторые SMART семейства могут отсутствовать на зеркале. Вы можете попробовать HMM поиск предложенный на <a href="http://smart.embl-heidelberg.de">SMART</a> сайте. </li> <li>TIGRFAM - зеркало TIGRFAM наборов областей выравниваний. </li><li>COG - зеркало COG базы данных ортологичных протеиновых семейств сфокусированных на прокариотах. Области выравниваний будут сгенерированы автоматически. Альтернативный поиск, "Cognitor", который запускает BLAST для протеинов для базы данных COG-согласованных последовательностей, предложено в <a href="http://www.ncbi.nlm.nih.gov/COG">COG</a> сайт.</li><li>KOG - копии эукариот для базы данных COG. KOGs не включены в данный набор, но представлены как отдельные данные.</li></ul> Больше информации о каждой базе данных находится здесь<a href="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd_help.shtml#CDSource">Откуда CDD контент появился?</a>. Annotate as Аннотации Name of the result annotations marking found conserved domains. Имя результирующих аннотаций, маркирующих найденные консервативные области. Local search Локальный поиск Perform the search on local machine or submit the search to NCBI for remote execution. Выплнить поиск на локальной машине или выполнить удаленный NCBI поиск. Expect value Ожидаемое значение Modifies the <a href="http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml#expect">E-value</a> threshold used for filtering results. False positive results should be very rare with the default setting of 0.01 (use a more conservative, i.e. lower setting for more reliable results), results with E-values in the range of 1 and above should be considered putative false positives. Изменяет <a href="http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml#expect">E-value</a> значение используя отфильтрованные результаты. Ложные положительные результаты будут очень редкими с дефолтным значением параметра 0.01 (используйте более консервативные значения, т. е. меньшее для значение для более надежных результатов), результаты со значением E-value в пределах от 1 и выше будут давать ложно положительные результаты. Database folder Папка базы данных Specifies database folder for local search. Устанавливает папку базы данных для локального поиска. CD Search Поиск консервативных доменов Finds conserved domains in protein sequences. In case conserved domains database is downloaded the search can be executed on local machine. The search also can be submitted to the NCBI for remote execution. Ищет консервативные области в протеиновых последовательностях. База данных консервативных областей представлена и поиск может быть выполнен на локальной машине. Также поиск может быть выполнен удаленно на NCBI. 'External tools' plugin has to be loaded. 'Плагин внешних инструментов' должен быть загружен. 'Remote blast' plugin has to be loaded. Плагин 'удаленного BLASTа' должен быть загружен. U2::LocalWorkflow::ComposeResultSubTask Compose alignment Составить выравнивание U2::LocalWorkflow::ConvertFilesFormatPrompter unset не указан from %1 из %1 Convert file %1 to selected format if it is not excluded. Конвертировать файл %1 в выбранный формат если он не исключен. U2::LocalWorkflow::ConvertFilesFormatWorker File Файл A file to perform format conversion Файл для конвертации формата File of selected format Файл заданного формата Excluded formats Исключенные форматы Input file won't be converted to any of selected formats. Входной файл должен быть конвертирован в один из выбранных форматов. Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Custom Частная Input file Входной файл Workflow Схема The file does not exist: %1 The file does not exist: %1 Convert Format: result folder is empty, default workflow folder is used Convert Format: result folder is empty, default workflow folder is used Unknown file format: Unknown file format: File Format Conversion Преобразование форматов файлов Converts the file to selected format if it is not excluded. Преобразовывает файл в выбранный формат если он не исключен. U2::LocalWorkflow::ConvertSnpeffVariationsToAnnotationsPrompter unset не указан Parses information in variations from %1 into annotations. U2::LocalWorkflow::ConvertSnpeffVariationsToAnnotationsWorker Input URL Входной путь Input variation file URL. Convert SnpEff Variations to Annotations Parses information, added to variations by SnpEff, into standard annotations. Produced from the input file name U2::LocalWorkflow::DNAStatWorker Input sequence Входная последовательность Sequence for which GC-content and GC3-content will be evaluated. Последовательность, для которой GC3-контент будет оценен. Result annotation Результирующая аннотация Resulted annotations, with GC-content and GC3-content. Результирующие аннотации с GC-контентом и GC3-контентом. GC-content GC-контент Evaluate GC-content. Оценить GC-контент. Evaluate GC1-content. Оценить GC1-контент. Evaluate GC2-content. Оценить GC2-контент. Evaluate GC3-content. Оценить GC3-контент. GC1-content GC1-контент GC2-content GC2-контент GC3-content GC3-контент DNA Statistics Статистики для последовательности ДНК Evaluates statistics for DNA sequences. Оценивает статистики для DNA последовательностей. Sequence must be nucleotide Последовательность должна быть нуклеотидной No statistics was selected Статистики не были выбраны U2::LocalWorkflow::DNAStatWorkerPrompter Evaluates GC-Content and GC3-Content. Оценивает GC-контент и GC3-контент. U2::LocalWorkflow::ExternalProcessWorker output data выходные данные %1 file was not created %1 файл не был создан U2::LocalWorkflow::ExternalProcessWorkerPrompter unset не указан %1 %1 U2::LocalWorkflow::ExtractAssemblyCoverageWorker Empty assembly slot Слот сборки пуст Error with assembly object Ошибка со сборкой Extract Coverage from Assembly Расчет покрытия по сборке Extract the coverage and bases quantity from the incoming assembly. этот элемент извлекает значение покрытия и качества из входной сборки. Format Формат Format to store the output. Формат для сохранения выходных файлов. Export Экспорт Data type to export. Тип данных для экспорта. Threshold Порог The minimum coverage value to export. минимальное покрытие для экспорта. U2::LocalWorkflow::ExtractAssemblyCoverageWorkerPrompter coverage in "%1" format покрытие в формате "%1" nothing ничего Exports %1 from the incoming assembly with threshold %2 to %3 in tab delimited plain text format. Экспортирует %1 из входной сборки с порогом %2 в %3 в текстовом формате. U2::LocalWorkflow::ExtractConsensusTaskHelper Extract consensus Извлечь консенсус Unknown consensus algorithm: Неизвестный консенсусный алгоритм: U2::LocalWorkflow::ExtractConsensusWorker Empty assembly slot Слот сборки пуст Error with assembly object Ошибка со сборкой U2::LocalWorkflow::ExtractConsensusWorkerPrompter Extracts the consensus sequence from the incoming assembly using the %1 algorithm. Извлекает консенсусную последовательность из входной сборки используя %1 алгоритм. U2::LocalWorkflow::ExtractMSAConsensusSequenceWorker Extract Consensus from Alignment as Sequence Извлечение консенсуса выравнивания как последовательности Extract the consensus sequence from the incoming multiple sequence alignment. Извлекает консенсусную последовательность из входного множественного выравнивания. Consensus sequence Консенсусная последовательность Provides resulting consensus as a sequence Выводит консенсус как последовательность Algorithm Алгоритм The algorithm of consensus extracting. Алгоритм извлечения консенсусной последовательности. Threshold Порог The threshold of the algorithm. Порог для алгоритма. Keep gaps Оставить пробелы Set this parameter if the result consensus must keep the gaps. Установить этот параметр если консенсус должен содержать пробелы. Extract Consensus from Alignment as Text Извлечение консенсуса выравнивания как текста Extract the consensus string from the incoming multiple sequence alignment. Извлекает консенсус как строку из входного множественного выравнивания. Extracts the consensus sequence from the incoming alignment(s) using the %1 algorithm. Извлекает консенсусную последовательность из входного выравниваня при помощи %1 алгоритма. U2::LocalWorkflow::ExtractMSAConsensusStringWorker Input alignment Входное выравнивание A alignment which consensus should be extracted Выравнивание, соответствующее консенсусу должно быть извлечено Consensus Консенсус Provides resulting consensus as a text Выводит консенсус как текст U2::LocalWorkflow::ExtractMSAConsensusTaskHelper Extract consensus Извлечь консенсус Unknown consensus algorithm: Неизвестный консенсусный алгоритм: U2::LocalWorkflow::ExtractMSAConsensusWorker Empty msa slot Empty msa slot Error with msa object Error with msa object U2::LocalWorkflow::FastQWriter Fastq writer: NULL sequence object Записать Fastq: нет последовательности U2::LocalWorkflow::FastqQualityTrimPrompter unset не указан %1 %1 Trim input sequence %1 from the end, using the quality threshold. Обрезает входные последовательности %1 от конца, используя порог качества. U2::LocalWorkflow::FastqQualityTrimWorker FASTQ Quality Trimmer Обрезание последовательностей в файле FASTQ с учетом качества прочтения The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Схема сканирует каждую входную последовательность начиная с конца для поиска первой позиции где качество больше или равно минимальному порогу качества. После этого происходит подрезание до этой позиции. Input File Входной файл Set of FASTQ reads files Набор файлов с FASTQ ридами Output File Выходной файл Output FASTQ files Выхордные FASTQ файлы Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output file name Имя выходного файла A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Имя выходного файла. Quality threshold Порог качества Quality threshold for trimming. порог качества для подрезания. Min Length Минимальная длина Too short reads are discarded by the filter. слишком короткие риды будут удалены. Trim both ends Обрезка обоих концов Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS обрезать оба конца рида или нет. Для ридов, полученных методом Сенгера, обычно необходимо установить значение Истина, а для ридов NGS — Ложь. Input file Входной файл Workflow Схема Custom Частная U2::LocalWorkflow::FetchSequenceByIdFromAnnotationPrompter unset не указан %1 %1 In each annotation from %1 search for accession ID and download the corresponding sequences. В каждой аннотации из %1 ищет доступные идентификаторы и скачивает соответствующие последовательности. U2::LocalWorkflow::FetchSequenceByIdFromAnnotationWorker Cannot create folder '%1' Не удается создать папку '%1' failed to load item '%1' from '%2' DB : %3 Не удалось загрузить '%1' из базы данных '%2': %3 Fetch Sequences by ID from Annotation Извлечение последовательностей по ID в аннотации Parses annotations to find any IDs and fetches corresponding sequences. Разделяет аннотации по поиску идентификаторов и извлекает соответствующие последовательности. Input annotations Входные аннотации The annotations are scanned for accesion ids. Аннотации сканируются для присвоения идентификаторов. Sequence Последовательность The downloaded sequences Скачанные последовательности U2::LocalWorkflow::FilterAnnotationsByQualifierPrompter unset не указан Filter annotations from %1 by given qualifier name and value. Фильтрует аннотации из %1 по данным квалификаторам. U2::LocalWorkflow::FilterAnnotationsByQualifierTask Filter annotations by qualifier task Filter annotations by qualifier task U2::LocalWorkflow::FilterAnnotationsByQualifierWorker Input annotations Входные аннотации Annotations to be filtered by name. Аннотации будут отфильтрованы по имени. Result annotations Результирующие аннотации Resulted annotations, filtered by name. Результирующие аннотации, отфильтрованные по имени. Qualifier name Имя квалификатора Name of the qualifier to use for filtering. Имя квалификатора, которое будет использовано для фильтрации. Qualifier value Значение квалификатора Text value of the qualifier to apply as filtering criteria Текстовое значение квалификатора, которое будет использовано в качестве критерия фильтрации Accept or filter Принять или фильтровать Selects the name filter: accept specified names or accept all except specified. Выбор имени фильтра: принять указанные имена или принять все кроме указанных. Filter Annotations by Qualifier Фильтрация аннотаций по квалификатору Filters annotations by Qualifier. Фильтрует аннотации по квалификатору. U2::LocalWorkflow::FilterAnnotationsPrompter unset не указан Filter annotations from %1 by supplied names. Фильтр аннотаций из %1 по прилагаемым именам. U2::LocalWorkflow::FilterAnnotationsTask Filter annotations task Задача фильтрации аннотаций The list of annotation names to accept/filter is empty The list of annotation names to accept/filter is empty Too big annotation names file Too big annotation names file Not enough memory to load the file with annotation names Not enough memory to load the file with annotation names U2::LocalWorkflow::FilterAnnotationsWorker Input annotations Входные аннотации Annotations to be filtered by name. Аннотации будут отфильтрованы по имени. Result annotations Результирующие аннотации Resulted annotations, filtered by name. Результирующие аннотации, отфильтрованные по имени. Annotation names Имена аннотаций List of annotation names, separated by spaces, that will be accepted or filtered. Список имен аннотаций, разделенных пробелами, которые будут приняты или отфильтрованы. Annotation names file Файл с именами аннотаций File with annotation names, separated by whitespaces, that will be accepted or filtered. Файл с именами аннотаций, разделенных пробелом или список имен аннотаций, который будет применен или отфильтрован. Используйте пробел в качестве разделителя. At least one of these parameters must be set: "Annotation names", "Annotation names file". Только один из этих параметров должен быть выбран: "Имена аннотаций", "Файл с именами аннотаций". Accept or filter Принять или фильтровать Selects the name filter: accept specified names or accept all except specified. Выбор имени фильтра: принять указанные имена или принять все кроме указанных. Filter Annotations by Name Фильтрация аннотаций по названию Filters annotations by name. Фильтрует аннотации по имени. U2::LocalWorkflow::FilterBamPrompter unset не указан %1 %1 Filter BAM/SAM files from %1 with SAMTools view. Фильтрует BAM/SAM файлы из %1 при помощи SAMTools. U2::LocalWorkflow::FilterBamWorker Filter BAM/SAM files Фильтрация BAM/SAM-файлов Filters BAM/SAM files using SAMTools view. фильтровать BAM/SAM файлы при помощи команды SAMTools view. BAM/SAM File BAM/SAM файлы Set of BAM/SAM files to filter Набор BAM/SAM файлов для фильтрации Filtered BAM/SAM files Отфильтрованные BAM/SAM файлы Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output name Выходное имя A name of an output BAM/SAM file. If default of empty value is provided the output name is the name of the first BAM/SAM file with .filtered extention. Имя выходного BAM/SAM файла. Output format Выходной формат Format of an output assembly file. Формат выходного файла сборки. Region Участок Regions to filter. For BAM output only. chr2 to output the whole chr2. chr2:1000 to output regions of chr 2 starting from 1000. chr2:1000-2000 to ouput regions of chr2 between 1000 and 2000 including the end point. To input multiple regions use the space seprator (e.g. chr1 chr2 chr3:1000-2000). участки для фильтрации. Только в случае выходных файлов в формате BAM. Например, chr2 - для всей chr2. chr2:1000 - для регионов chr 2, начиная с 1000. chr2:1000-2000 - для регионов chr2 между 1000 и 2000, включая конец интервала. Для ввода нескольких участков используйте пробел (напр, chr1 chr2 chr3:1000-2000). MAPQ threshold Порог MAPQ Minimum MAPQ quality score. минимальная оценка качества MAPQ. Accept flag Флаг принятия Only output alignments with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. включить в выходной файл только риды с выбранными характеристиками. Выберите элементы для составления флага. Не выбирайте ничего, если фильтровать риды не нужно (если выбран один параметр, риды будут отфильтрованы по нему). Skip flag Флаг игнорирования Skip alignment with the selected items. Select the items in the combobox to configure bit flag. Do not select the items to avoid filtration by this parameter. исключить из выходного файла риды с выбранными характеристиками. Выберите элементы для составления флага. Не выбирайте ничего, если фильтровать риды не нужно. Custom Частная Input file Входной файл Workflow Схема Unknown file format: Unknown file format: U2::LocalWorkflow::FindAllRegionsTask FindAllRegionsTask FindAllRegionsTask U2::LocalWorkflow::FindPrompter unset не указан translated транслированной A substring must %1. Подстрока обязательна %1. match a pattern exactly сопоставить паттерн точно Maximum number of mismatches is %1. Максимальное число несовпадений равно %1. %1 pattern(s) %1 паттерн(ы) patterns from %1 паттерны из %1 and %1 и %1 using pattern names использовать имя паттерна Searches regions in each sequence from %1 similar to %2%3. %4 Searches in %5 of a %6sequence. Outputs the regions found annotated as %7. Ищет регионы в каждой последовательности начиная с %1 по %2%3. %4 Ищет в %5 %6 последовательностях. Выходные регионы аннотируются как %7. U2::LocalWorkflow::FindWorker Found %1 matches of pattern '%2' Найдено %1 вхождений паттерна "%2" Input Data Входная последовательность An input sequence to search in. Последовательность, для которой применяется алгоритм поиска. Pattern Annotations Найденные аннотации The regions found. Аннотации, найденные для последовательности. Name of the result annotations. Имя аннотаций для найденных регионов. Use pattern name Использовать имя паттерна If patterns are loaded from a file, use names of pattern sequences as annotation names. The name from the parameters is used by default. Если паттерны загружаются из файла, используйте имена паттернов последовательностей как имена аннотаций. Имена из параметров используются по умолчанию. Max Mismatches Допустимо несовпадений Maximum number of mismatches between a substring and a pattern. Максимальное допустимое число несовпадений между подпоследовательностью и паттерном. Allow Insertions/Deletions Разрешить вставки/делеции Takes into account possibility of insertions/deletions when searching. By default substitutions are only considered. В случае когда допустимы несовпадения между подпоследовательностью и паттерном учитывает вставки/делеции. По умолчанию учитываются только замены. Support ambiguous bases Поддержка неопределенных баз Performs correct handling of ambiguous bases. When this option is activated insertions and deletions are not considered. Выполняет корректную обработку неопределенных баз. Когда эта опция включена вставки и удаления не рассматриваются. Search in Translation Искать в трансляции Translates a supplied nucleotide sequence to protein and searches in the translated sequence. Указывает транслировать входную нуклеотидную последовательность в протеиновую и искать указанный паттерн в полученной протеиновой последовательности. Searches regions in a sequence similar to a pattern sequence. Outputs a set of annotations. Поиск подпоследовательностей, похожих на указанный паттерн, в каждой входной последовательности (нуклеотидной или протеиновой). both strands в обеих цепях direct strand прямой цепи complement strand комплементарной цепи Load file with patterns Загрузить файл с паттернами Empty pattern given Пустой паттерн Find algorithm subtasks Подзадача алгоритма поиска Annotate as Аннотации Qualifier name for pattern name Имя квалифаера для имени паттерна Name of qualifier in result annotations which is containing a pattern name. Имя квалифаера в результирующих аннотациях, которое содержит имя паттерна. Find Pattern Поиск подстроки Null sequence supplied to FindWorker: %1 Пустая последовательность для поиска подстрок: %1 U2::LocalWorkflow::GFFWriter GFF writer: NULL sequence object Записать GFF: нет последовательности U2::LocalWorkflow::GenbankWriter Genbank writer: NULL sequence object Записать Genbank: нет последовательности U2::LocalWorkflow::GetFileListPrompter Gets paths of files: %1. Получить пути файлов из %1. U2::LocalWorkflow::GetFileListWorker Paths read by the element. Пути прочитанные по элементу. Output URL Выходной путь Input URL Входной путь Produces URL(s) to files from specified folders. этот элемент производит пути до файлов из указанных папок. File List Получение списка файлов U2::LocalWorkflow::GroupPrompter Groups all incoming messages into one message. Сгруппировать все входящие сообщения в одно сообщение. Groups all incoming messages %1 of %2 slot data. Сгруппировать все входящие сообщения %1 от %2 слота. by id по идентификатору by name по имени by value по значению U2::LocalWorkflow::GroupWorker Input data flow Входной поток данных Group size Размер группы Size of the created group. Размер создаваемой группы. Grouped output data flow Сгруппированный выходной поток данных Out slots Выходные слоты Group slot Групповой слот Group operation Операция группировки Grouper Группер Groups data supplied to the specified slot by the specified property (for example, by value). Additionally, it is possible to merge data from another slots associated with the specified one. этот элемент группирует данные, передаваемые по указанному слоту по заданному свойству (например, по значению). Кроме того, можно объединить данные из других слотов, ассоциированных с указанным. U2::LocalWorkflow::ImportAnnotationsWorker Load documents with annotations Загрузить документы с аннотациями Input annotations Входные аннотации Input annotation table. Read annotations will be added to it Таблица входных аннотаций. Прочитанные аннотации будут добавлены к ней Output annotations Выходные аннотации Output annotation table Таблица выходных аннотаций Merge Annotations Объединение аннотаций Read input annotation table and merge it with supplied annotation tables. Читает таблицу входных аннотаций и объединяте их с исходными таблицами аннотаций. Merge input annotations with annotations from %1. Объединяет входные аннотации с аннотациями из %1. U2::LocalWorkflow::KAlignSubTask Max region size: %1 Max region size: %1 Core region: %1-%2 Core region: %1-%2 The %1 algorithm is not found. Add the %1 plugin. The %1 algorithm is not found. Add the %1 plugin. The %1 algorithm is not found. Check that the %1 plugin is up to date. The %1 algorithm is not found. Check that the %1 plugin is up to date. U2::LocalWorkflow::LaunchExternalToolTask Launch external process task Запуск задачи внутреннего процесса Running external process: %1 Запускается внутренний процесс: %1 Can't launch %1 Невозможно запустить %1 U2::LocalWorkflow::LoadMSATask File '%1' not exists Файл '%1' не существует Unsupported document format: %1 Неподдерживаемый формат документа: %1 Reading MSA from %1 [%2] Читается множественное выравнивание из %1 [формат %2] Read MSA from %1 Чтение выравнивания из %1 U2::LocalWorkflow::LoadSeqTask File '%1' not exists Файл '%1' не существует Unsupported document format: %1 Неподдерживаемый формат документа: %1 Reading sequences from %1 [%2] Читается последовательность из %1 [формат %2] Read sequences from %1 Чтение последовательности из %1 U2::LocalWorkflow::MSAFromSequencesTask MSAFromSequencesTask MSAFromSequencesTask U2::LocalWorkflow::MSAWriter Empty alignment passed for writing to %1 Пустое выравнивание для записи в %1 U2::LocalWorkflow::MarkSequencePrompter Adds one or several marks to the input sequence. Промаркировать входную последовательность. U2::LocalWorkflow::MarkSequenceWorker Location Расположение Location of sequence Расположение последовательности Sequence Последовательность Marked sequence Маркированная последовательность Sequence Marker Маркировка последовательностей Adds one or several marks to the input sequence depending on the sequence properties. Use this element, for example, in conjunction with the Filter element. этот элемент маркирует входную последовательность в зависимости от ее свойств. Используйте данный элемент, например, в сочетании с элементом "Фильтрация". Markers Маркеры Markers. Маркеры. U2::LocalWorkflow::MergeBamPrompter unset не указан %1 %1 Merge BAM files from %1 with SAMTools merge. Соединяет BAM файлы из%1 при помощи SAMTools. U2::LocalWorkflow::MergeBamWorker Merge BAM files Соединение BAM-файлов Merge BAM files using SAMTools merge. Соединить BAM файлы при помощи SAMTools. BAM File BAM файлы Set of BAM files to merge Набор BAM файлов для слияния Merged BAM File Соединенный BAM файл Merged BAM file Соединенный BAM файл Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output BAM name Имя выходного BAM файла A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .merged.bam extention. Имя выходного BAM файла. Custom Частная Input file Входной файл Workflow Схема Unknown file format: Unknown file format: U2::LocalWorkflow::MergeFastqPrompter unset не указан from %1 из %1 Merges input sequences %1. Соединяет входные файлы %1. U2::LocalWorkflow::MergeFastqWorker FASTQ Merger Слияние файлов FASTQ Merges input sequences to one output file этот элемент соединяет входные последовательности в один выходной файл Input File Входной файл Set of FASTQ reads files Набор файлов с FASTQ ридами Output File Выходной файл Output FASTQ file Выходной FASTQ файл Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output file name Имя выходного файла A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Имя выходного файла. Custom Частная Input file Входной файл Workflow Схема U2::LocalWorkflow::MultiplexerPrompter unset не указан Gets one message from %1 and one message from %2, joins them into a single message, and transfers it to the output. Repeats this while there are available messages in both input ports. Принять по одному сообщению от каждого из элементов %1 и %2, объединить эти сообщения в одно и передать его дальше. Повторять процедуру до тех пор, пока в обоих входных портах имеются сообщения. Gets one message from %1, joins it with each message from %2, and transfers the joined messages to the output. Repeats this for each message from %1. Принимает сообщение от элемента %1, объединяет его по очереди с каждым сообщением от элемента %2 и отправляет полученные сообщения дальше. Процедура повторяется до тех пор, пока имеются сообщения от %1. U2::LocalWorkflow::MultiplexerWorker Multiplexing rule Правило мультиплексирования First input port Первый входной порт The number of messages, received from "%1" (%2), does not correspond to the number of messages, received from "%3" (%4). Redundant messages were skipped. One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from this port is concatenated with messages from the other port. Один из входных портов Мультиплексера. В случае, если задано правило мультиплексирования "1 to many", сообщения из этого порта объединяются с каждым сообщением из другого порта. Second input port Второй входной порт One of the two input ports of the Multiplexer element. When rule "1 to many" is set up, each message from the other port is concatenated with messages from this port. Один из входных портов Мультиплексера. В случае, если задано правило мультиплексирования "1 to many", сообщения из другого порта объединяются с каждым сообщением из этого порта. Multiplexed output Мультиплексированные сообщения The port outputs multiplexed messages. Сообщения, полученные в результате объединения двух потоков сообщений. Specifies how to multiplex the input messages: <li>1 to 1 - the multiplexer gets one message from the first input port and one message from the second input port, joins them into a single message, and transfers it to the output. This procedure is repeated while there are available messages in both input ports.</li> <li>1 to many - the multiplexer gets one message from the first input port, joins it with each message from the second input port, and transfers the joined messages to the output. This procedure is repeated for each message from the first input port.</li> данный параметр определяет способ объединения сообщений из двух входных портов: значение <li>1 to 1 означает, что одно сообщение из первого входного порта объединяется с одним сообщением из второго входного порта. Полученное мультиплексированное сообщение передается на выход. Данная процедура повторяется до тех пор, пока в обоих портах имеются сообщения. Значение </li> <li>1 to many означает, что одно сообщение из первого входного порта по очереди объединяется с каждым сообщением из второго входного порта. Мультиплексированные сообщения передаются на выход. Процедура повторяется до тех пор, пока в первом порте имеются сообщения. </li> 1 to many 1 to 1 Multiplexer Мультиплексер The element allows one to join two data flows into a single data flow, i.e. to join messages from two input ports into concatenated messages and send them to the output. The concatenation approach is determined by the Multiplexing rule parameter. этот элемент позволяет объединять данные из двух различных источников, а именно объединять сообщения, пришедшие во входные порты, в комплексные мультиплексированные сообщения. Способ объединения сообщений задается с помощью параметра Правило мультиплексирования. U2::LocalWorkflow::PairwiseAlignmentTask Can't translate read sequence to reverse complement Can't translate read sequence to reverse complement U2::LocalWorkflow::PassFilterPrompter unset не указан %1 %1 Filters input data from %1 by value(s) %2. Отфильтровать входные данные из %1 по значениям %2. U2::LocalWorkflow::PassFilterWorker Input values Входные данные Input values. Входные данные. Filtered data Отфильтрованные данные Filter by value(s) Фильтровать по значениям Comma-separated list of values used to filter the input data. принимает на вход список значений, разделенных запятой, который будет использован для фильтрации входных данных. Filter Фильтрация Passes through only data that matches the input filter value (or values). этот элемент отфильтровывает входные данные по заданному значению (или значениям). U2::LocalWorkflow::QualityTrimPrompter unset не указан %1 %1 Trim input sequence %1 from the end, using the quality threshold. Обрезает входные последовательности %1 от конца, используя порог качества. U2::LocalWorkflow::QualityTrimWorker FASTQ Quality Trimmer Обрезание последовательностей в файле FASTQ с учетом качества прочтения The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Схема сканирует каждую входную последовательность начиная с конца для поиска первой позиции где качество больше или равно минимальному порогу качества. После этого происходит подрезание до этой позиции. Input File Входной файл Set of FASTQ reads files Набор файлов с FASTQ ридами Output File Выходной файл Output FASTQ files Выхордные FASTQ файлы Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output file name Имя выходного файла A name of an output file. If default of empty value is provided the output name is the name of the first file with additional extention. Имя выходного файла. Quality threshold Порог качества Min Length Минимальная длина Custom Частная Input file Входной файл Workflow Схема U2::LocalWorkflow::RCWorker Input sequence Входная последовательность The sequence to be complemented Последовательность была комплементирована Output sequence Выходная последовательность Reverse-complement sequence Обратно-комплементарная последовательность Operation type Тип операции Select what to do with sequence. Выберите, что сделать с последовательностью. Reverse Complement Создание обратно-комплементарной последовательности Converts input sequence into its reverse, complement or reverse-complement counterpart Конвертирует входную последовательность в обратную, комплементарную или обратно-комплементарную Null sequence object supplied to FindWorker Ничего не подается в элемент поиска Null sequence supplied to FindWorker: %1 Пустая последовательность для поиска подстрок: %1 Can't complement amino sequence Невозможно комплементировать амино последовательность Can't find complement translation Невозможно найти комплементарную трансляцию U2::LocalWorkflow::RCWorkerPrompter unset не указан from %1 из %1 Converts each input sequence %1 into its %2 counterpart. Конвертирует каждую входную последовательность %1 в ее %2 копию. U2::LocalWorkflow::RawSeqWriter Raw sequence writer: NULL sequence object Записать колонки последовательностей: нет последовательностей U2::LocalWorkflow::ReadAnnotationsTask Read annotations from %1 Читать аннотации из %1 File '%1' does not exist Файл '%1' не существует Unsupported document format: %1 Неподдерживаемый формат документа: %1 Reading annotations from %1 [%2] Чтение аннотаций из %1 [%2] U2::LocalWorkflow::ReadAnnotationsWorker Read Annotations Чтение аннотаций Reads annotations from files. All annotation file formats supported by UGENE are allowed as input to this element. этот элемент считывает аннотации из файлов. Annotations Аннотации Annotations. Аннотации. Mode Режим <ul><li>"Separate" mode keeps the tables as they are;</li><li>"Merge from file" unites annotation tables from one file into one annotations table;</li><li>"Merge from dataset" unites all annotation tables from all files from dataset;</li></ul> Annotation table name The name for the result annotation table that contains merged annotation data from file or dataset. Separate annotation tables Merge annotation tables from file Merge all annotation tables from dataset If the file contains more than one annotation table, Split mode sends them "as is" to the output, while Merge appends all the annotation tables and outputs the sole merged annotation table.In Merge files is the same as Merge but it operates with all annotation tables from all files of one dataset. Если файл содержит более одной таблицы аннотаций, Разбиение отправляет все аннотации на выход, Сшивка добавляет все таблицы и выводит одну объединенную таблицу аннотаций. В Сшивка файлов одинаково с Сшивка но работает со всеми таблицами аннотаций из всех файлов одного набора. Split Разбиение Merge Сшивка Merge files Сшивка файлов Reads annotations from %1. Прочитать аннотации из %1. U2::LocalWorkflow::ReadAssemblyWorker Read Assembly Чтение сборки Reads assembly from files. All assembly file formats supported by UGENE are allowed as input to this element. этот элемент считывает сборки из файлов. Assembly Сборка Reads assembly from %1. Прочитать сборку из %1. U2::LocalWorkflow::ReadVariationTask Read variations from %1 Чтение вариаций из %1 File '%1' not exists Файл '%1' не существует Unsupported document format: %1 Неподдерживаемый формат документа: %1 Reading variations from %1 [%2] Чтение вариаций из %1 [%2] Incorrect track object in %1 Некорректный трек объект в %1 U2::LocalWorkflow::ReadVariationWorker Read Variations Чтение вариаций Reads variations from files and produces variations tracks. All variation file formats supported by UGENE are allowed as input to this element. этот элемент читает вариации из файлов и производит наборы вариаций. Variation track Трек вариации Split Alleles Разбиение аллели If the file contains variations with multiple alleles (chr1 100 C G,A), No split mode sends them "as is" to the output, while Split splits them into two variations (chr1 100 C G and chr1 100 C A). если файл содержит вариации с несколькими аллелями (chr1 100 C G,A), режим без разбиенияа подает такую строку на выход без изменений, в то время как режим разбиение разбивает строку на две (chr1 100 C G и chr1 100 C A). Split Разбиение No split Не разбивать Reads variations from %1. Прочитать вариации из %1. U2::LocalWorkflow::RemoteDBFetcherPrompter unset не указан U2::LocalWorkflow::RemoteDBFetcherWorker sequences identified with последовательности с идентификаторами sequence identified with последовательность с идентификатором sequences identified with resource IDs that will be read from files последовательности, определенные идентификаторами, которые будут прочитаны из файлов sequences identified with resource IDs that will be read from file последовательности, определенные идентификаторами, которые будут прочитаны из файлов Save result to %1 folder. Сохранить результат в папку %1. Reads %1 %2 from %3 remote database. %4 Прочитать %1 %2 из удаленной базы данных %3. %4 Cannot create folder '%1' Не удается создать папку '%1' failed to load item '%1' from '%2' DB : %3 Не удалось загрузить '%1' из базы данных '%2': %3 Read from Remote Database Чтение из удаленной базы данных Reads sequences and annotations if any from a remote database. этот элемент загружает последовательности, а также аннотации в случае их наличия, из удаленной базы данных. Sequence Последовательность Database База данных The database to read from. выберите удаленную базу данных, из которой требуется загрузить данные. Read resource ID(s) from source Идентификаторы из источника The source to read resource IDs from: the list or a local file. источник идентификаторов (список или локальный файл). File with resource IDs Файл с идентификаторами A file with a list of resource ID`s in the database (one per line). Файл с идентификаторами в базе данных (по одному в строке). Resource ID(s) Идентификаторы Semicolon-separated list of resource ID`s in the database. Список идентификаторов ресурсов в базе данных. Различные значения отделяются друг от друга с помощью ";". Например: "NC_001363;D11266". Save file to folder Сохранить в папку The folder to store sequence files loaded from a database. Папка, в которую будут сохранены файлы, загруженные из базы данных. NCBI database База данных NCBI U2::LocalWorkflow::RenameChomosomeInVariationPrompter unset не указан %1 %1 For each variation from %1 replace chromosome prefix%2 %3 with %4 prefix. Для каждой вариации из %1 переписывает префикс хромосомы%2 %3 с %4 префиксом. U2::LocalWorkflow::RenameChomosomeInVariationWorker An unexpected task type An unexpected task type Source file URL is empty Source file URL is empty Change Chromosome Notation for VCF Изменение обозначения хромосомы для VCF Changes chromosome notation for each variant from the input VCF or other variation files. этот элемент изменяет обозначения хромосом для каждой вариации из входного VCF-файла или других файлов. Input file URL Входной файл Input files(s) with variations, usually in VCF format. Входные файлы с вариациями, обычно в VCF формате. Output file URL Выходной файл Output file(s) with annotated variations. Выходной файл с аннотированными вариациями. Produced URL Производимые пути Location of a corresponding produced file. Расположение выходного файла. Replace prefixes Заменить префиксы Input the list of chromosome prefixes that you would like to replace, for example "NC_000". Separate different prefixes by semicolons. введите список префиксов, которые необходимо переписать, например "NC_000". Разделяйте префиксы точкой с запятой. Replace by Заменить Input the prefix that should be set instead, for example "chr". введите префикс, на который нужно заменить указанные префиксы, например "chr". U2::LocalWorkflow::RmdupBamPrompter unset не указан %1 %1 Remove PCR duplicates of BAM files from %1 with SAMTools rmdup. Удаляет дубликаты PCR из BAM файлов из %1 при помощи SAMTools. U2::LocalWorkflow::RmdupBamWorker Remove Duplicates in BAM Files Удаление дубликатов в BAM-файлах Remove PCR duplicates of BAM files using SAMTools rmdup. Удаляет дубликаты PCR из BAM файлов при помощи SAMTools. BAM File BAM файлы Set of BAM files to rmdup Набор BAM файлов для удаления дубликатов Cleaned BAM File Обработанный BAM файл Cleaned BAM file Обработанный BAM файл Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output BAM name Имя выходного BAM файла A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .nodup.bam extention. Имя выходного BAM файла. Remove for single-end reads Удалить для непарных ридов Remove duplicate for single-end reads. By default, the command works for paired-end reads only (-s). Удаляет дубликаты для непарных ридов. По умолчанию, команда работает только для парных ридов (-s). Treat as single-end Считать как непарные Treat paired-end reads and single-end reads (-S). Считать парные и непарные риды (-S). Custom Частная Input file Входной файл Workflow Схема Unknown file format: Unknown file format: U2::LocalWorkflow::SamtoolsRmdupTask Samtool rmdup for %1 Samtool rmdup для %1 No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: Can not run %1 tool Can not run %1 tool %1 tool exited with code %2 %1 tool exited with code %2 Tool %1 finished successfully Tool %1 finished successfully U2::LocalWorkflow::SamtoolsSortTask No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: U2::LocalWorkflow::SamtoolsViewFilterTask Samtool view (filter) for %1 Samtool view (filter) for %1 No assembly URL to filter No assembly URL to filter Folder does not exist: Folder does not exist: Can not run %1 tool Can not run %1 tool %1 tool exited with code %2 %1 tool exited with code %2 Tool %1 finished successfully Tool %1 finished successfully U2::LocalWorkflow::SchemaWorker Some workflow is in this element. Есть схема в этом элементе. U2::LocalWorkflow::ScriptWorker For input port was set empty data type Для входного порта указан пустой тип данных For output port was set empty data type Для выходного порта указан пустой тип данных Input data Входные данные Output data Выходные данные no script text нет текста скрипта U2::LocalWorkflow::ScriptWorkerTask Error in line Ошибка в строке Script worker task Задача скриптового элемента U2::LocalWorkflow::SequenceQualityTrimPrompter unset не указан from %1 из %1 Trim input sequence %1 from %2, using the quality threshold. U2::LocalWorkflow::SequenceQualityTrimWorker There is no sequence object in the message An unexpected task type An unexpected task type Sequence was filtered out by quality Sequence Quality Trimmer The workflow scans each input sequence from the end to find the first position where the quality is greater or equal to the minimum quality threshold. Then it trims the sequence to that position. If a the whole sequence has quality less than the threshold or the length of the output sequence less than the minimum length threshold then the sequence is skipped. Схема сканирует каждую входную последовательность начиная с конца для поиска первой позиции где качество больше или равно минимальному порогу качества. После этого происходит подрезание до этой позиции. Input Sequence Set of sequences to trim by quality Output Sequence Trimmed sequences Trimming quality threshold Quality threshold Порог качества Quality threshold for trimming. порог качества для подрезания. Min length Min Length Минимальная длина Too short reads are discarded by the filter. слишком короткие риды будут удалены. Trim both ends Обрезка обоих концов Trim the both ends of a read or not. Usually, you need to set True for Sanger sequencing and False for NGS обрезать оба конца рида или нет. Для ридов, полученных методом Сенгера, обычно необходимо установить значение Истина, а для ридов NGS — Ложь. U2::LocalWorkflow::SequenceSplitPromter unset не указан from %1 из %1 %1 it if annotation marks translated subsequence, %1 если аннотация маркирует транслированную подпоследовательность translate трансляция make it %1 if annotation is located on complement strand, %1 аннотация располагается в комплементарной цепи expand it to left with %1, расширить влево на %1, expand it to right with %1 расширить враво на %1 Extract each annotated sequence region %5 %2 %3%4 Извлечь каждый аннотированный регион последовательности %5 %2 %3%4 U2::LocalWorkflow::SequenceSplitWorker No sequence provided to split worker Разделяющим элементом не произведено последовательностей Nothing to extract. Sequence '%1' has no annotations. Нечего извлекать. последовательность '%1' не имеет аннотаций. Nothing to extract: no sequence region match the constraints Нечего извлекать: ни один регион последовательност ине соответствует ограничениям Input sequence Входная последовательность A sequence which will be split into annotated regions. Последовательность, которая будет разделена на аннотированные регионы. Annotated regions Аннотированные регионы Resulted subsequences, translated and complemented according to corresponding annotations. Результирующие подпоследовательности, которые были транслированы и комплементированы в соответствии с аннотациями. Translate Транслировать Translate the annotated regions. Транслировать аннотированные регионы. Complement Комплементарная Complement the annotated regions if the corresponding annotation is located on complement strand. Комплементировать аннотированные регионы если соответствубщая аннотация расположена в комплементарной цепи. Split joined Разделить связывание Split joined annotations to single region annotations. Разделяет связанные аннотации на одиночные регионы. Extend left Расширить влево Extend the resulted regions to left. Расширение результирующего региона влево. Extend right Расширить вправо Extend the resulted regions to right. Расширение результирующего региона вправо. Gap length Длина пробела Insert gap of specified length between merged locations of annotation. Вставить пробел указанной длины между соединяемыми позициями аннотации. Get Sequences by Annotations Извлечение последовательностей, соответствующих аннотациям Creates sequences from annotated regions of input sequence. Создает последовательности из аннотированных регионов входных последовательностей. U2::LocalWorkflow::SequencesToMSAPromter Creates multiple sequence alignment from supplied sequences. Создает выравнивание последовательносетй из прилагаемых последовательностей. U2::LocalWorkflow::SequencesToMSAWorker Input sequences Входные последовательности Sequences to be joined into alignment. Последовательности будут добавлены к выравниванию. Result alignment Результирующее выравнивание Alignment created from the given sequences. Выравнивание созданное из данных последовательностей. Join Sequences into Alignment Соединение последовательностей в выравнивание Creates multiple sequence alignment from sequences. Создает множественное выравнивание из последовательностей. U2::LocalWorkflow::SortBamPrompter unset не указан from %1 из %1 Sort BAM file %1 with SAMTools sort. Сортирует BAM файл %1 при помощи SAMTools. U2::LocalWorkflow::SortBamWorker Sort BAM Files Сортировка BAM-файлов Sort BAM Files using SAMTools Sort. Сортирует BAM файлы при помощи SAMTools. BAM File BAM файлы Set of BAM files to sort Набор BAM файлов для сортировки Sorted BAM File Отсортированный BAM файл Sorted BAM file Отсортированный BAM файл Output folder Выходная папка Select an output folder. Custom - specify the output folder in the 'Custom folder' parameter. Workflow - internal workflow folder. Input file - the folder of the input file. выберите выходную папку. Частная - укажите папку в параметре 'Частная папка'. Заданная - внутренняя папка дизайнера. Входной файл - папка входного файла. Custom folder Частная папка Select the custom output folder. Укажите частную выходную папку. Output BAM name Имя выходного BAM файла A name of an output BAM file. If default of empty value is provided the output name is the name of the first BAM file with .sorted.bam extention. Имя выходного BAM файла. Build index Построить индекс Build index for the sorted file with SAMTools index. Построить индекс для отсортированного файла при помощи SAMTools. Custom Частная Input file Входной файл Workflow Схема Unknown file format: Unknown file format: U2::LocalWorkflow::Text2SequencePrompter unset не указан from %1 из %1 sequence with name %1 последовательность с именем %1 Automatically detect sequence alphabet Автоматически определить алфавит последовательности Set sequence alphabet to %1 Установить алфавит последовательности %1 skipped игнорировать replaced with symbol заменить символом Convert input text%1 to %2. %3. Unknown symbols are %4. Конвертировать входной текст %1 to %2. %3. Неизвестные символы %4. U2::LocalWorkflow::Text2SequenceWorker Sequence name not set Имя последовательности не задано skip flag should be set or replace character defined пропустить флаг, который должен быть установлен или переписать определенный символ Alphabet cannot be automatically detected Алфавит не может быть определен автоматически Alphabet '%1' cannot be found Алфавит '%1' не найден Input text Входной текст A text which will be converted to sequence Текст, который будет конвертирован в последовательность Output sequence Выходная последовательность Converted sequence Сконвертированная последовательность Sequence name Имя последовательности Result sequence name. Имя результирующей последовательности. Select one of the listed alphabets or choose auto to auto-detect. Выберите один из предлашаемых алфавитов или выберите автоопределение. Do not include symbols that are not contained in alphabet. Не включать символы которые не содержатся в алфавите. Replace unknown symbols with given character. Переписать неизвестные символы данным символом. Sequence alphabet Алфавит последовательности Skip unknown symbols Игнорировать неизвестные символы Replace unknown symbols with Переписать неизвестные символы Convert Text to Sequence Преобразование текста в последовательность Converts input text to sequence. Преобразовываеь входной текст в последовательность. U2::LocalWorkflow::TextReader Can't load the object %1 from the database %2 Can't load the object %1 from the database %2 Can't load file %1 Не удается загрузить файл %1 Can't load file %1. %2 Невозможно загрузить файл %1. %2 U2::LocalWorkflow::WriteAnnotationsPrompter unset не указан default file файл по умолчанию Save all annotations from %1 to %2 Сохранить все аннотации из %1 в %2 in %1 format. в формат %1. in the в database. базе данных. U2::LocalWorkflow::WriteAnnotationsWorker Unrecognized formatId: '%1' Unrecognized formatId: '%1' Invalid shared DB URL Invalid shared DB URL Invalid path in shared DB Invalid path in shared DB Unrecognized data storage: '%1' Unrecognized data storage: '%1' Unspecified URL to write Unspecified URL to write Unrecognized data storage Unrecognized data storage Annotations name not specified. Default value used: '%1' Annotations name not specified. Default value used: '%1' Nothing to write Нет данных для записи Input annotations Входные аннотации Input annotations which will be written to output file Входные аннотации, которые будут записаны в выходной файл Merge annotation tables If true all annotation tables from dataset will be merged into one. The value of Annotation table name parameter will be used as the name of result annotation table. Annotation table name The name for the result annotation table that contains merged annotation data from file or dataset. If true all annotation tables from dataset will be merged into one annotation object. The value of Annotation object name parameter will be used as the name of result annotation object. Annotations name Имя аннотаций Name of the saved annotations. This option is only available for document formats that support saving of annotations names. имя для сохранения аннотаций. Этот параметр доступен только для форматов, которые поддерживают сохранение имен аннотаций. Annotation object name Имя объекта аннотации Name of the saved annotation object. Имя аннотаций: имя для сохранения объекта аннотации. CSV separator Разделитель CSV String which separates values in CSV files. символ, который разделяет значения в файлах CSV. Write sequence names Записать имена последовательностей Add names of sequences into CSV file. добавить имена последовательностей в CSV-файл. Write Annotations Запись аннотаций Writes all supplied annotations to file(s) in selected format. этот элемент записывает все аннотации в файл заданного формата. U2::LocalWorkflow::WriteBAMWorker Assembly Сборка Write Assembly Запись сборки Writes all supplied assemblies to file(s) in selected format. этот элемент записывает все сборки в файл(ы) заданного формата. Location Расположение Location for writing data Путь к файлу для записи данных Save all assemblies from %1 to %2. Сохранить все сборки из %1 в %2. U2::LocalWorkflow::WriteVariationWorker Write variations: internal error Запись вариаций: внутренняя ошибка Variation track Изменение вариации Write Variations Запись вариаций Writes all supplied variations to file(s) in selected format. этот элемент записывает все прилагаемые вариации в файл(ы) заданного формата. Location Расположение Location for writing data Путь к файлу для записи данных Save all variations from %1 to %2. Сохранить все вариации из %1 в %2. U2::NameFilterLayout Type to filter by name... Тип для фильтрации по имени... Name filter: Имя фильтра: Esc Отмена U2::ProduceSchemaImageLinkTask Save workflow image Сохранить схему как изображение Cannot find workflow: %1 Невозможно найти схему: %1 U2::RenameChromosomeInVariationFileTask Rename chomosome name file with variations Rename chomosome name file with variations File doesn't contains variant tracks File doesn't contains variant tracks File format is not recognized (%1) File format is not recognized (%1) U2::RenameChromosomeInVariationTask Rename task Rename task U2::SampleActionsManager This task requires the following plugins: %1. Add them and try again, please. This task requires the following plugins: %1. Add them and try again, please. U2::SaveWorkflowSceneTask Save workflow scene task Сохранить задачу схемы U2::SequenceQualityTrimTask Trim sequence by quality The sequence '%1' was filtered out by quality The trimming was skipped for the sequences without quality information. U2::StartupDialog You have no write access to the folder. Please choose another one. Вы не имеете прав на запись в папку. Выберите другую папку. U2::Workflow::CoreLib Write FASTA Запись FASTA Read Plain Text Чтение текста Reads text from local or remote files. All text file formats supported by UGENE are allowed as input to this element. этот элемент считывает текстовые данные из файлов, расположенных локально или удаленно. Write Plain Text Запись текста Write strings to a file. этот элемент записывает текстовые данные в файл. Writes all supplied sequences to file(s) in selected format. этот элемент записывает последовательности в файл(ы) заданного формата. Save all sequences from %1 to %2. Сохранить все последовательности из %1 в %2. Another worker with this name is already registered: %1 Другой эелемент с таким именем уже был зарегистрирован: %1 The actor '%1' has been already registered Метка '%1' уже была зарегистрирована Sequence Последовательность Plain text Текстовые данные Location Путь к файлу Reads text from %1. Прочитать текст из %1. Save text from %1 to %2. Сохранить текст из %1 в %2. Multiple sequence alignment Множественное выравнивание Save all MSAs from %1 to %2. Сохранить множественные выравнивания из %1 в %2. Write Alignment Запись множественного выравнивания Writes all supplied alignments to file(s) in selected format. этот элемент записывает все входные выравнивания в файл(ы) заданного формата. Write Sequence Запись последовательности Read Sequence Чтение последовательности Reads sequence(s) from %1. Прочитать последовательности из %1. Read Alignment Чтение множественного выравнивания Reads MSA(s) from %1. Прочитать множественное(ые) выравнивание(я) из %1. A sequence of any type (nucleotide, protein). Биологические последовательности разных видов (ДНК, РНК, протеины). Location for writing data Путь к файлу для записи данных A sequence along with FASTA header line. Последовательность вместе с заголовком FASTA. Writes all supplied sequences to file(s) in FASTA format. этот элемент записывает все входные данные в файл(ы) в формате FASTA. Reads multiple sequence alignments (MSAs) from local or remote files. All MSA file formats supported by UGENE are allowed as input to this element.Besides recognized alignment formats, it supports aligning from a set of sequences in a corresponding file (e.g. FASTA or Genbank). этот элемент считывает множественные выравнивания из файлов, расположенных локально или удаленно. Помимо чтения готовых выравниваний известных форматов, поддерживается автоматическое составление выравниваний из наборов последовательностей, которые могут быть прочитаны из файла любого подходящего формата (например, FASTA или Genbank). Reads sequences and annotations if any from local or remote files. All sequence file formats supported by UGENE (e.g. GenBank, FASTA) are allowed as input to this element. этот элемент загружает последовательности, а также аннотации в случае их наличия, из файлов, расположенных локально или удаленно. U2::Workflow::GalaxyConfigConfigurationDialogImpl Set UGENE folder Установить папку UGENE Set Galaxy folder Установить папку Galaxy Set destination folder Установить папку назначения U2::Workflow::PortAliasesConfigurationDialog Cancel Отмена OK OK Input Вход Output Выход Workflow Designer Дизайнер вычислительных схем There is a port with some aliased slots but without alias name: %1 Есть порт без имени алиаса слота: %1 Slot aliases of one port must be different! Алиасы слотов одного порта должны быть разными! Port aliases must be different! Rename one of ports: %1 or %2 Алиасы портов должны быть разными! Переименуйте алиас одного из портов: %1 или %2 U2::Workflow::ReadAssemblyTask Read assembly from %1 Прочитать сборку из %1 File '%1' not exists Файл '%1' не существует File '%1' does not exist Файл '%1' не существует Unsupported document format: %1 Неподдерживаемый формат документа: %1 Can not read assemblies from the file: %1 Невозможно прочитать сборки из файла: %1 Reading assembly from %1 [%2] Чтение сборки из %1 [%2] No assemblies in the file: %1 Нет сборок в файле: %1 Incorrect assembly object in %1 Некорректная сборка в %1 U2::Workflow::SchemaAliasesConfigurationDialogImpl Cancel Отмена OK OK U2::Workflow::SeqReadPrompter Mode Режим If the file contains more than one sequence, Split mode sends them "as is" to the output, while Merge appends all the sequences and outputs the sole merged sequence. при наличии более одной последовательности в файле режим Разбиение отправляет их в исходном виде на выходной порт по одной, в то время как режим Сшивка соединяет все последовательности в одну и отправляет ее на выходной порт. Merging gap Сшивка с помощью пробелов In Merge mode, the specified number of gaps are inserted between the original sequences. This is helpful, for example, to avoid finding false positives at the merge boundaries. в режиме Сшивка между исходными последовательностями добавляется указанное число пробелов. В частности, это помогает избежать нахождения ложноположительных сигналов на границах, по которым шла сшивка исходных последовательностей. Accession filter Фильтр по идентификаторам Reports only sequences containing the specified regular expression.Leave it empty to switch off this filter. Use * to mask many symbol and use ? to mask one symbol. Sequence count limit Ограничение количества последовательностей Split mode only.Read only first N sequences from each file. Set 0 value for reading all sequences. работает только в режиме Разбиение. В этом случае из каждого файла считываются только первые N последовательностей. Чтобы прочитать все последовательности, установите нулевое значение чтобы прочитать все последовательности установите нулевое значение N. Split Разбиение Merge Сшивка U2::Workflow::WriteDocPrompter unset не указан in the в database. базе данных. U2::Workflow::WriteFastaPrompter Writes sequence(s) in %1 format to %2. Сохранить последовательности в формате %1 в %2. Writes sequence(s) from %1 in %2 format to %3. Запись последовательностей из %1 в %3 в формате %2. U2::Workflow::WriteGenbankPrompter sequence from %1 последовательности из %1 set of annotations from %1 набора аннотаций из %1 Write sequence(s) in Genbank format to %1. Запись последовательностей в формате Genbank в %1. each %1 and %2 каждые %1 и %2 each каждые Write %1 in Genbank format, to %2. Запись %1 в формате Genbank в %2. U2::WorkflowDesignerPlugin Workflow Designer Дизайнер вычислительных схем Workflow Designer allows to create complex computational workflows. Дизайнер вычислительных схем позволяет создавать и переиспользовать многоэтапные алгоритмы обработки данных. Алгоритмы создаются в виде визуальных диаграмм потоков данных, не требуя навыков программирования или знания языков программирования. Runs the specified task. Выполняет указанную задачу. Runs the specified task. A path to a user-defined UGENE workflow be used as a task name. Запускает указанную задачу. Путь до пользовательской UGENE схемы будет использован для имени задачи. <task_name> [<task_parameter>=value ...] <task_name> [<task_parameter>=value ...] Prints the content of the specified slot. Печатает содержимое указанного слота. Prints the content of the specified slot. The incoming/outcoming content of specified slot is printed to the standart output. Печатает содержимое указанного слота. Входное/выходное содержимое указанного слота печатается стандартно. <actor_name>.<port_name>.<slot_name> <actor_name>.<port_name>.<slot_name> Creates new Galaxy tool config. Создает новую конфигурацию Galaxy-инструмента. Creates new Galaxy tool config from existing workflow. Paths to UGENE and Galaxy can be set Создает новую конфигурацию для инструмента Galaxy из существующей схемы. Пути для UGENE и Galaxy могут быть установлены <uwl-file> [--ugene-path=value] [--galaxy-path=value] <uwl-file> [--ugene-path=value] [--galaxy-path=value] Close Designer Закрытие дизайнера схем Close Designer canceled Закрытие дизайнера схем отменено U2::WorkflowDesignerService Workflow Designer Дизайнер вычислительных схем Workflow Designer... Дизайнер вычислительных схем... New workflow... Новая схема... Can not open Workflow Designer. Please, try to reload UGENE. Невозможно открыть дизайнер вычислительных схем. Попробуйте перезагрузить UGENE. Reads quality control and alignment Контроль качества коротких прочтений и выравнивание Reads quality control... Контроль качества коротких прочтений... Filter short scaffolds... Raw DNA-Seq data processing Обработка сырых данных секвенирования ДНК Variant calling Поиск вариаций Variant calling and effects prediction Annotate variants and predict effects Аннотация вариаций и предсказание эффекта Raw RNA-Seq data processing Обработка сырых данных секвенирования РНК RNA-Seq data analysis Анализ данных секвенирования РНК Extract transcript sequences Извлечение последовательности транскриптов Raw ChIP-Seq data processing Обработка сырых данных ChIP-Seq ChIP-Seq data analysis Анализ данных ChIP-Seq ChIP-Seq coverage Покрытие ChIP-Seq Extract coverage from assemblies Расчет покрытия по сборке Extract consensus from assemblies Извлечение консенсуса из сборки Remote NCBI BLAST Удаленный поиск с помощью NCBI BLAST U2::WorkflowDocFormat Workflow Схема WorkflowDoc is a format used for creating/editing/storing/retrievingworkflow with the text file Формат схем это формат используемый для создания/редактирования/восстановления схемы с текстовым файлом Invalid header. %1 expected Неверный заголовок. Ожидается %1 U2::WorkflowEditor Element name: Имя элемента: Input data Входные данные Output data Выходные данные Select an element to inspect. Выберите элемент для просмотра или редактирования. To configure the parameters of the element go to "Parameters" area below. Параметры элемента можно отредактировать в таблице, расположенной ниже. You can observe data slots of the port and configure connections if any in the "Parameters" widget suited below. Слоты данных, входящие в порт, указаны в таблице, расположенной немного ниже. Там же можно изменить привязку данных в связях, если они есть. %1 "%2" of task "%3": %4 %5 %1 "%2" задачи "%3": %4 %5 Parameters Параметры Output port Выходной порт Input port Входной порт Name Имя Value Значение Script Скрипт U2::WorkflowInvestigationWidgetsController Messages from ' Сообщения из ' ' to ' ' в ' ' ' U2::WorkflowMetaDialog Cancel Отмена OK OK Save workflow to file Сохранить схему в файл U2::WorkflowPaletteElements Can't remove element %1 Не могу удалить элемент %1 Expand all Развернуть все Collapse all Свернуть все Edit Изменить Remove Удалить U2::WorkflowRemoteRunFromCMDLineTask %1 parameter expected, but not set Не установлен параметр %1 Cannot read remote machine settings from %2 Не удается прочитать настройки удаленной машины из %2 U2::WorkflowRunFromCMDLineBase Workflow run from cmdline Запуск схемы из командной строки no task to run нет задач для выполнения Cannot find workflow: %1 Невозможно найти схему: %1 alias '%1' not set in workflow алиас '%1' не установлен в схеме Incorrect value for '%1', null or default value passed to workflow Некорректное значение '%1', нулевое или дефолтное значение передано схеме actor parameter '%1' not found текущий параметр '%1' не найден cannot parse value from '%1' невозможно разобрать значение из '%1' U2::WorkflowScene Open document(s) Открыть документы Workflow Designer Дизайнер вычислительных схем Unable to open specified documents. Watch log for details. Невозможно открыть указанные документы. Посмотрите лог для выяснения деталей. Drop an element from the palette here Перенесите сюда элемент из палитры U2::WorkflowSettingsPageController Workflow Designer Дизайнер вычислительных схем U2::WorkflowTabView Close dashboard Закрыть панель Rename Dashboard Переименовать панель New dashboard name: Имя новой панели: Run Запуск Rename Переименовать U2::WorkflowUtils UGENE workflow element UGENE элемент U2::WorkflowView Workflow Designer Дизайнер схем Error list Проблемы Warning! Предупреждение! Undefined workflow format for %1 Неизвестный workflow формат в %1 file файл &Save workflow as... &Сохранить схему как... Show wizard Показать визард Delete Удалить Can't load element. Невозможно загрузить элемент. Can't remove element %1 Не могу удалить элемент %1 Element style Стиль Error Ошибка Select all elements Выбрать все элементы Import workflow to element... Импортировать схему в элемент... Create Galaxy tool config... Создать конфигурацию Galaxy инструмента... &Copy &Копировать Cu&t &Вырезать &Paste &Вставить Minimal Упрощённый Extended Развёрнутый Add element Добавить элемент &Run workflow &Запустить схему S&top workflow О&тменить выполнение схемы &Validate workflow &Проверить валидность схемы &Estimate workflow &Оценить время на выполнение схемы &Pause workflow &Остановить схему &Next step &Следующий шаг Process one &message По одному &сообщению &New workflow... &Новая схема... &Save workflow &Сохранить схему &Load workflow &Загрузка схемы &Export workflow as image &Экспорт схемы в изображение Dashboards manager Менеджер панелей Set parameter aliases... Выбрать алиасы параметров... Set port and slot aliases... Выбрать алиасы портов и слотов... Hide scripting options Не показывать опции скриптинга Show scripting options Показывать опции скриптинга Create element with script... Создать элемент при помощи скрипта... Edit script of the element... Изменить скрипт элемента... Create element with command line tool... Создать элемент при помощи командной строки... Edit configuration... Изменить конфигурацию... Add element with command line tool... Добавить элемент при помощи командной строки... Empty workflow! Пустая схема! Nothing to run: empty workflow Выполнять нечего: схема пуста Workflow cannot be executed Схема не может быть выполнена Please fix issues listed in the error list (located under workflow). Исправьте ошибки представленные в списке ошибок (располодженный под схемой). Well done! Готово! There are non-critical warnings. Нет критических ошибок. Workflow is valid Схема валидна Aliases for workflow parameters should be different! Алиасы для параметров схемы должны бть разными! Workflow does not contain any parameter aliases Схема не содержит алиасов параметров Internal error! Веутренняя ошибка! Can not create Galaxy config Невозможно создать конфигурацию Galaxy The workflow contains a wizard. Sorry, but current version of UGENE doesn't support of wizards in the includes. Схема содержит визард. Текущая версия UGENE не поддерживает визарды в схемах. File is not found: %1 Файл не найден: %1 Show dashboard Показать панель Show workflow Показать схему Open workflow file Открыть файл схемы New workflow Новая схема The workflow has been modified. Do you want to save changes? Схема была изменена. Вы хотите сохранить изменения? Scripting mode Скриптинг Element properties Свойства элемента Workflow is valid. Схема валидна. Bad input! Неверные входные данные! Workflow Designer - %1 Дизайнер схем - %1 Drag the palette element to the scene or just click on the scene to add the element. Перетащите элемент из палитры на плоскость или просто кликните мышью в нужном месте схемы. Elements Элементы Samples Примеры Unlock Scene Разблокировать схему Invalid content: duplicate process %1 Ошибка: дубликат процесса %1 Invalid content: unknown process type %1 Ошибка: неизвестный тип задачи "%1" U2::WorkflowViewFactory Open multiple views Открытие нескольких окон Workflow Designer Дизайнер вычислительных схем WorkflowEditorWidget Form Форма Property Editor Редактор объектов TextLabel Название Parameters Параметры Input data Входные данные Output data Выходные данные WorkflowMetaDialog Workflow Properties Описание схемы Location Путь ... ... Name Имя Comment Комментарий WorkflowSettingsWidget Resource settings Источник настроек Scene appearance Сцена Element style Стиль Element font Шрифт Element background color Цвет фона Enable debugger Включить отладку Directories Use directory for output files Directory for custom elements with scripts Directory for custom elements with command line tools Directory for included schema elements Use folder for output files Использовать папку для выходных файлов Folder for custom elements with scripts Папка для элементов пользователя со скриптами Folder for custom elements with command line tools Папка для элементов пользователя с внешними утилитами Folder for included schema elements Папка для включенных элементов схемы Show grid Показывать сетку Track running progress Отображать прогресс выполнения схемы Folders Папки Snap to grid Привязываться к сетке Runtime settings Исполнение схем WriteDocPrompter default file файл по умолчанию