
:>"^O*                @   s  d  Z  d d l m Z d d l m Z d d l m Z d d l m Z m	 Z	 Gd d   d e
  Z Gd d	   d	 e
  Z Gd
 d   d e
  Z Gd d   d e
  Z Gd d   d e
  Z Gd d   d e e  Z Gd d   d e  Z Gd d   d e  Z Gd d   d e e  Z Gd d   d e e  Z Gd d   d e e  Z Gd d   d e e  Z Gd d   d e e  Z Gd  d!   d! e
  Z e d" k rd d# l m Z e   d$ S)%a  Represent a Sequence Feature holding info about a part of a sequence.

This is heavily modeled after the Biocorba SeqFeature objects, and
may be pretty biased towards GenBank stuff since I'm writing it
for the GenBank parser output...

What's here:

Base class to hold a Feature
----------------------------

Classes:
 - SeqFeature

Hold information about a Reference
----------------------------------

This is an attempt to create a General class to hold Reference type
information.

Classes:
 - Reference

Specify locations of a feature on a Sequence
--------------------------------------------

This aims to handle, in Ewan Birney's words, 'the dreaded fuzziness issue'.
This has the advantages of allowing us to handle fuzzy stuff in case anyone
needs it, and also be compatible with BioPerl etc and BioSQL.

Classes:
 - FeatureLocation - Specify the start and end location of a feature.
 - CompoundLocation - Collection of FeatureLocation objects (for joins etc).
 - ExactPosition - Specify the position as being exact.
 - WithinPosition - Specify a position occurring within some range.
 - BetweenPosition - Specify a position occurring between a range (OBSOLETE?).
 - BeforePosition - Specify the position as being found before some base.
 - AfterPosition - Specify the position as being found after some base.
 - OneOfPosition - Specify a position where the location can be multiple positions.
 - UnknownPosition - Represents missing information like '?' in UniProt.

    )print_function)OrderedDict)_is_int_or_long)
MutableSeqreverse_complementc               @   s  e  Z d  Z d Z d d d d d d d d d d d 	 Z d d   Z d	 d
   Z e d e d e d d  Z d d   Z	 d d   Z
 e d e	 d e
 d d  Z d d   Z d d   Z e d e d e d d  Z d d   Z d d   Z e d e d e d d  Z d d   Z d  d!   Z d" d#   Z d$ d%   Z d& d'   Z d( d d) d* d d d+ d,  Z d- d.   Z e Z d/ d0   Z d1 d2   Z d3 d4   Z d S)5
SeqFeatureai  Represent a Sequence Feature on an object.

    Attributes:
     - location - the location of the feature on the sequence (FeatureLocation)
     - type - the specified type of the feature (ie. CDS, exon, repeat...)
     - location_operator - a string specifying how this SeqFeature may
       be related to others. For example, in the example GenBank feature
       shown below, the location_operator would be "join". This is a proxy
       for feature.location.operator and only applies to compound locations.
     - strand - A value specifying on which strand (of a DNA sequence, for
       instance) the feature deals with. 1 indicates the plus strand, -1
       indicates the minus strand, 0 indicates stranded but unknown (? in GFF3),
       while the default of None indicates that strand doesn't apply (dot in GFF3,
       e.g. features on proteins). Note this is a shortcut for accessing the
       strand property of the feature's location.
     - id - A string identifier for the feature.
     - ref - A reference to another sequence. This could be an accession
       number for some different sequence. Note this is a shortcut for the
       reference property of the feature's location.
     - ref_db - A different database for the reference accession number.
       Note this is a shortcut for the reference property of the location
     - qualifiers - A dictionary of qualifiers on the feature. These are
       analogous to the qualifiers from a GenBank feature table. The keys of
       the dictionary are qualifier names, the values are the qualifier
       values. As of Biopython 1.69 this is an ordered dictionary.

    N z<unknown id>c
       
      C   s   | d k	 r8 t  | t  r8 t  | t  r8 t d   | |  _ | |  _ | rY | |  _ | d k	 rn | |  _ | |  _ | d k r t	   } | |  _
 | d k	 r t d   | d k	 r | |  _ |	 d k	 r |	 |  _ d S)a$  Initialize a SeqFeature on a Sequence.

        location can either be a FeatureLocation (with strand argument also
        given if required), or None.

        e.g. With no strand, on the forward strand, and on the reverse strand:

        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> f1 = SeqFeature(FeatureLocation(5, 10), type="domain")
        >>> f1.strand == f1.location.strand == None
        True
        >>> f2 = SeqFeature(FeatureLocation(7, 110, strand=1), type="CDS")
        >>> f2.strand == f2.location.strand == +1
        True
        >>> f3 = SeqFeature(FeatureLocation(9, 108, strand=-1), type="CDS")
        >>> f3.strand == f3.location.strand == -1
        True

        An invalid strand will trigger an exception:

        >>> f4 = SeqFeature(FeatureLocation(50, 60), strand=2)
        Traceback (most recent call last):
           ...
        ValueError: Strand should be +1, -1, 0 or None, not 2

        Similarly if set via the FeatureLocation directly:

        >>> loc4 = FeatureLocation(50, 60, strand=2)
        Traceback (most recent call last):
           ...
        ValueError: Strand should be +1, -1, 0 or None, not 2

        For exact start/end positions, an integer can be used (as shown above)
        as shorthand for the ExactPosition object. For non-exact locations, the
        FeatureLocation must be specified via the appropriate position objects.

        Note that the strand, ref and ref_db arguments to the SeqFeature are
        now obsolete and will be deprecated in a future release (which will
        give warning messages) and later removed. Set them via the location
        object instead.

        Note that location_operator and sub_features arguments can no longer
        be used, instead do this via the CompoundLocation object.
        NzEFeatureLocation, CompoundLocation (or None) required for the locationz7Rather than sub_features, use a CompoundFeatureLocation)
isinstanceFeatureLocationCompoundLocation	TypeErrorlocationtypelocation_operatorstrandidr   
qualifiersrefref_db)
selfr   r   r   r   r   r   Zsub_featuresr   r    r   3/tmp/pip-build-ww9dw3qa/biopython/Bio/SeqFeature.py__init__\   s*    9									zSeqFeature.__init__c             C   s
   |  j  j S)z/Get function for the strand property (PRIVATE).)r   r   )r   r   r   r   _get_strand   s    zSeqFeature._get_strandc             C   sV   y | |  j  _ Wn? t k
 rQ |  j  d k rJ | d k	 rM t d   n   Yn Xd S)z/Set function for the strand property (PRIVATE).Nz$Can't set strand without a location.)r   r   AttributeError
ValueError)r   valuer   r   r   _set_strand   s    zSeqFeature._set_strandfgetfsetdoczuFeature's strand

                          This is a shortcut for feature.location.strand
                          c             C   s+   y |  j  j SWn t k
 r& d SYn Xd S)z2Get function for the reference property (PRIVATE).N)r   r   r   )r   r   r   r   _get_ref   s    zSeqFeature._get_refc             C   sV   y | |  j  _ Wn? t k
 rQ |  j  d k rJ | d k	 rM t d   n   Yn Xd S)z2Set function for the reference property (PRIVATE).Nz!Can't set ref without a location.)r   r   r   r   )r   r   r   r   r   _set_ref   s    zSeqFeature._set_refzFeature location reference (e.g. accession).

                       This is a shortcut for feature.location.ref
                       c             C   s+   y |  j  j SWn t k
 r& d SYn Xd S)z;Get function for the database reference property (PRIVATE).N)r   r   r   )r   r   r   r   _get_ref_db   s    zSeqFeature._get_ref_dbc             C   s   | |  j  _ d S)z;Set function for the database reference property (PRIVATE).N)r   r   )r   r   r   r   r   _set_ref_db   s    zSeqFeature._set_ref_dbzFeature location reference's database.

                          This is a shortcut for feature.location.ref_db
                          c             C   s+   y |  j  j SWn t k
 r& d SYn Xd S)z:Get function for the location operator property (PRIVATE).N)r   operatorr   )r   r   r   r   _get_location_operator   s    z!SeqFeature._get_location_operatorc             C   s]   | rY t  |  j t  r' | |  j _ n2 |  j d k rI t d |   n t d |   d S)z:Set function for the location operator property (PRIVATE).Nz2Location is None so can't set its operator (to %r)z+Only CompoundLocation gets an operator (%r))r	   r   r   r%   r   )r   r   r   r   r   _set_location_operator   s    z!SeqFeature._set_location_operatorz5Location operator for compound locations (e.g. join).c             C   s   d |  j  j t |  j  f } |  j r? | d t |  j  7} |  j r_ | d t |  j  7} |  j r |  j d k r | d t |  j  7} |  j r | d t |  j  7} |  j r | d t |  j  7} | d 7} | S)	z0Represent the feature as a string for debugging.z%s(%sz	, type=%sz, location_operator=%sz<unknown id>z, id=%sz, ref=%sz, ref_db=%s))		__class____name__reprr   r   r   r   r   r   )r   answerr   r   r   __repr__  s    				
zSeqFeature.__repr__c             C   s   d |  j  } | d |  j 7} |  j rG |  j d k rG | d |  j 7} | d 7} x2 t |  j  D]! } | d | |  j | f 7} qa W| S)z+Return the full feature as a python string.z	type: %s
zlocation: %s
z<unknown id>zid: %s
zqualifiers:
z    Key: %s, Value: %s
)r   r   r   sortedr   )r   outZqual_keyr   r   r   __str__!  s    
zSeqFeature.__str__c             C   sI   t  d |  j j |  d |  j d |  j d |  j d t |  j j     S)zyReturn a copy of the feature with its location shifted (PRIVATE).

        The annotation qaulifiers are copied.
        r   r   r   r   r   )	r   r   _shiftr   r   r   r   r   items)r   offsetr   r   r   r1   ,  s    			zSeqFeature._shiftc             C   sI   t  d |  j j |  d |  j d |  j d |  j d t |  j j     S)a  Return a copy of the feature with its location flipped (PRIVATE).

        The argument length gives the length of the parent sequence. For
        example a location 0..20 (+1 strand) with parent length 30 becomes
        after flipping 10..30 (-1 strand). Strandless (None) or unknown
        strand (0) remain like that - just their end points are changed.

        The annotation qaulifiers are copied.
        r   r   r   r   r   )	r   r   _flipr   r   r   r   r   r2   )r   lengthr   r   r   r4   9  s    
			zSeqFeature._flipc             C   s+   |  j  d k r t d   |  j  j |  S)a  Extract the feature's sequence from supplied parent sequence.

        The parent_sequence can be a Seq like object or a string, and will
        generally return an object of the same type. The exception to this is
        a MutableSeq as the parent sequence will return a Seq object.

        This should cope with complex locations including complements, joins
        and fuzzy positions. Even mixed strand features should work! This
        also covers features on protein sequences (e.g. domains), although
        here reverse strand features are not permitted.

        >>> from Bio.Seq import Seq
        >>> from Bio.Alphabet import generic_protein
        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> seq = Seq("MKQHKAMIVALIVICITAVVAAL", generic_protein)
        >>> f = SeqFeature(FeatureLocation(8, 15), type="domain")
        >>> f.extract(seq)
        Seq('VALIVIC', ProteinAlphabet())

        If the FeatureLocation is None, e.g. when parsing invalid locus
        locations in the GenBank parser, extract() will raise a ValueError.

        >>> from Bio.Seq import Seq
        >>> from Bio.SeqFeature import SeqFeature
        >>> seq = Seq("MKQHKAMIVALIVICITAVVAAL", generic_protein)
        >>> f = SeqFeature(None, type="domain")
        >>> f.extract(seq)
        Traceback (most recent call last):
           ...
        ValueError: The feature's .location is None. Check the sequence file for a valid location.

        Note - currently only compound features of type "join" are supported.
        NzNThe feature's .location is None. Check the sequence file for a valid location.)r   r   extract)r   parent_sequencer   r   r   r6   K  s    "	zSeqFeature.extractZStandard*Fc       
      C   s   | d k rF y t  |  j d d  d } Wn t k
 rE d } Yn X| d k rg t d j |    |  j |  | d  } |  j j d | g  d }	 | d k r |  j d k } | j d	 |	 d
 | d | d | d |  S)a
  Get a translation of the feature's sequence.

        This method is intended for CDS or other features that code proteins
        and is a shortcut that will both extract the feature and
        translate it, taking into account the codon_start and transl_table
        qualifiers, if they are present. If they are not present the
        value of the arguments "table" and "start_offset" are used.

        The "cds" parameter is set to "True" if the feature is of type
        "CDS" but can be overridden by giving an explicit argument.

        The arguments stop_symbol, to_stop and gap have the same meaning
        as Seq.translate, refer to that documentation for further information.

        Arguments:
         - parent_sequence - This method will translate DNA or RNA sequences,
           and those with a nucleotide or generic alphabet. Trying to
           translate a protein sequence raises an exception.
         - table - Which codon table to use if there is no transl_table
           qualifier for this feature. This can be either a name
           (string), an NCBI identifier (integer), or a CodonTable
           object (useful for non-standard genetic codes).  This
           defaults to the "Standard" table.
         - start_offset - offset at which the first complete codon of a
           coding feature can be found, relative to the first base of
           that feature. Has a valid value of 0, 1 or 2. NOTE: this
           uses python's 0-based numbering whereas the codon_start
           qualifier in files from NCBI use 1-based numbering.
           Will override a codon_start qualifier

        >>> from Bio.Seq import Seq
        >>> from Bio.Alphabet import generic_dna
        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> seq = Seq("GGTTACACTTACCGATAATGTCTCTGATGA", generic_dna)
        >>> f = SeqFeature(FeatureLocation(0, 30), type="CDS")
        >>> f.qualifiers['transl_table'] = [11]

        Note that features of type CDS are subject to the usual
        checks at translation. But you can override this behaviour
        by giving explicit arguments:

        >>> f.translate(seq, cds=False)
        Seq('GYTYR*CL**', HasStopCodon(ExtendedIUPACProtein(), '*'))

        Now use the start_offset argument to change the frame. Note
        this uses python 0-based numbering.

        >>> f.translate(seq, start_offset=1, cds=False)
        Seq('VTLTDNVSD', ExtendedIUPACProtein())

        Alternatively use the codon_start qualifier to do the same
        thing. Note: this uses 1-based numbering, which is found
        in files from NCBI.

        >>> f.qualifiers['codon_start'] = [2]
        >>> f.translate(seq, cds=False)
        Seq('VTLTDNVSD', ExtendedIUPACProtein())
        NZcodon_startr         zThe start_offset must be 0, 1, or 2. The supplied value is {}. Check the value of either the codon_start qualifier or the start_offset argumentZtransl_tableZCDStablestop_symbolto_stopcdsgap)r   r9   r:   )	intr   KeyErrorr   formatr6   getr   	translate)
r   r7   r;   Zstart_offsetr<   r=   r>   r?   Zfeat_seqZcodon_tabler   r   r   rD   t  s&    F	zSeqFeature.translatec             C   s   d S)a  Boolean value of an instance of this class (True).

        This behaviour is for backwards compatibility, since until the
        __len__ method was added, a SeqFeature always evaluated as True.

        Note that in comparison, Seq objects, strings, lists, etc, will all
        evaluate to False if they have length zero.

        WARNING: The SeqFeature may in future evaluate to False when its
        length is zero (in order to better match normal python behaviour)!
        Tr   )r   r   r   r   __bool__  s    zSeqFeature.__bool__c             C   s   t  |  j  S)a  Return the length of the region where the feature is located.

        >>> from Bio.Seq import Seq
        >>> from Bio.Alphabet import generic_protein
        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> seq = Seq("MKQHKAMIVALIVICITAVVAAL", generic_protein)
        >>> f = SeqFeature(FeatureLocation(8, 15), type="domain")
        >>> len(f)
        7
        >>> f.extract(seq)
        Seq('VALIVIC', ProteinAlphabet())
        >>> len(f.extract(seq))
        7

        This is a proxy for taking the length of the feature's location:

        >>> len(f.location)
        7

        For simple features this is the same as the region spanned (end
        position minus start position using Pythonic counting). However, for
        a compound location (e.g. a CDS as the join of several exons) the
        gaps are not counted (e.g. introns). This ensures that len(f) matches
        len(f.extract(parent_seq)), and also makes sure things work properly
        with features wrapping the origin etc.
        )lenr   )r   r   r   r   __len__  s    zSeqFeature.__len__c             C   s   t  |  j  S)aj  Iterate over the parent positions within the feature.

        The iteration order is strand aware, and can be thought of as moving
        along the feature using the parent sequence coordinates:

        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> f = SeqFeature(FeatureLocation(5, 10), type="domain", strand=-1)
        >>> len(f)
        5
        >>> for i in f: print(i)
        9
        8
        7
        6
        5
        >>> list(f)
        [9, 8, 7, 6, 5]

        This is a proxy for iterating over the location,

        >>> list(f.location)
        [9, 8, 7, 6, 5]
        )iterr   )r   r   r   r   __iter__  s    zSeqFeature.__iter__c             C   s   | |  j  k S)a  Check if an integer position is within the feature.

        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> f = SeqFeature(FeatureLocation(5, 10), type="domain", strand=-1)
        >>> len(f)
        5
        >>> [i for i in range(15) if i in f]
        [5, 6, 7, 8, 9]

        For example, to see which features include a SNP position, you could
        use this:

        >>> from Bio import SeqIO
        >>> record = SeqIO.read("GenBank/NC_000932.gb", "gb")
        >>> for f in record.features:
        ...     if 1750 in f:
        ...         print("%s %s" % (f.type, f.location))
        source [0:154478](+)
        gene [1716:4347](-)
        tRNA join{[4310:4347](-), [1716:1751](-)}

        Note that for a feature defined as a join of several subfeatures (e.g.
        the union of several exons) the gaps are not checked (e.g. introns).
        In this example, the tRNA location is defined in the GenBank file as
        complement(join(1717..1751,4311..4347)), so that position 1760 falls
        in the gap:

        >>> for f in record.features:
        ...     if 1760 in f:
        ...         print("%s %s" % (f.type, f.location))
        source [0:154478](+)
        gene [1716:4347](-)

        Note that additional care may be required with fuzzy locations, for
        example just before a BeforePosition:

        >>> from Bio.SeqFeature import SeqFeature, FeatureLocation
        >>> from Bio.SeqFeature import BeforePosition
        >>> f = SeqFeature(FeatureLocation(BeforePosition(3), 8), type="domain")
        >>> len(f)
        5
        >>> [i for i in range(10) if i in f]
        [3, 4, 5, 6, 7]

        Note that is is a proxy for testing membership on the location.

        >>> [i for i in range(10) if i in f.location]
        [3, 4, 5, 6, 7]
        )r   )r   r   r   r   r   __contains__  s    2zSeqFeature.__contains__)r*   
__module____qualname____doc__r   r   r   propertyr   r!   r"   r   r#   r$   r   r&   r'   r   r-   r0   r1   r4   r6   rD   rE   __nonzero__rG   rI   rJ   r   r   r   r   r   ?   sd   K				,[r   c               @   sR   e  Z d  Z d Z d d   Z d d   Z d d   Z d d	   Z d
 d   Z d S)	Referenceaw  Represent a Generic Reference object.

    Attributes:
     - location - A list of Location objects specifying regions of
       the sequence that the references correspond to. If no locations are
       specified, the entire sequence is assumed.
     - authors - A big old string, or a list split by author, of authors
       for the reference.
     - title - The title of the reference.
     - journal - Journal the reference was published in.
     - medline_id - A medline reference for the article.
     - pubmed_id - A pubmed reference for the article.
     - comment - A place to stick any comments about the reference.

    c             C   sL   g  |  _  d |  _ d |  _ d |  _ d |  _ d |  _ d |  _ d |  _ d S)zInitialize the class.r   N)r   authorsconsrtmtitlejournal
medline_id	pubmed_idcomment)r   r   r   r   r   i  s    							zReference.__init__c             C   s   d } x |  j  D] } | d | 7} q W| d |  j 7} |  j rS | d |  j 7} | d |  j 7} | d |  j 7} | d |  j 7} | d |  j 7} | d	 |  j 7} | S)
z4Return the full Reference object as a python string.r   zlocation: %s
zauthors: %s
zconsrtm: %s
z
title: %s
zjournal: %s
zmedline id: %s
zpubmed id: %s
zcomment: %s
)r   rQ   rR   rS   rT   rU   rV   rW   )r   r/   Zsingle_locationr   r   r   r0   t  s    	zReference.__str__c             C   s   d |  j  j t |  j  f S)z9Represent the Reference object as a string for debugging.z%s(title=%s, ...))r)   r*   r+   rS   )r   r   r   r   r-     s    zReference.__repr__c             C   s   |  j  | j  k o |  j | j k o |  j | j k o |  j | j k o |  j | j k o |  j | j k o |  j | j k o |  j | j k S)zCheck if two Reference objects should be considered equal.

        Note prior to Biopython 1.70 the location was not compared, as
        until then __eq__ for the FeatureLocation class was not defined.
        )rQ   rR   rS   rT   rU   rV   rW   r   )r   otherr   r   r   __eq__  s    zReference.__eq__c             C   s   |  | k S)z Implement the not-equal operand.r   )r   rX   r   r   r   __ne__  s    zReference.__ne__N)	r*   rK   rL   rM   r   r0   r-   rY   rZ   r   r   r   r   rP   X  s   rP   c               @   sT  e  Z d  Z d Z d d d d d  Z d d   Z d d   Z e d	 e d
 e d d  Z d d   Z	 d d   Z
 d d   Z d d   Z d d   Z d d   Z d d   Z d d   Z d d   Z d d    Z d! d"   Z d# d$   Z e d% d&    Z e d' d(    Z e d) d*    Z e d+ d,    Z e d- d.    Z d/ d0   Z d S)1r
   a  Specify the location of a feature along a sequence.

    The FeatureLocation is used for simple continuous features, which can
    be described as running from a start position to and end position
    (optionally with a strand and reference information).  More complex
    locations made up from several non-continuous parts (e.g. a coding
    sequence made up of several exons) are described using a SeqFeature
    with a CompoundLocation.

    Note that the start and end location numbering follow Python's scheme,
    thus a GenBank entry of 123..150 (one based counting) becomes a location
    of [122:150] (zero based counting).

    >>> from Bio.SeqFeature import FeatureLocation
    >>> f = FeatureLocation(122, 150)
    >>> print(f)
    [122:150]
    >>> print(f.start)
    122
    >>> print(f.end)
    150
    >>> print(f.strand)
    None

    Note the strand defaults to None. If you are working with nucleotide
    sequences you'd want to be explicit if it is the forward strand:

    >>> from Bio.SeqFeature import FeatureLocation
    >>> f = FeatureLocation(122, 150, strand=+1)
    >>> print(f)
    [122:150](+)
    >>> print(f.strand)
    1

    Note that for a parent sequence of length n, the FeatureLocation
    start and end must satisfy the inequality 0 <= start <= end <= n.
    This means even for features on the reverse strand of a nucleotide
    sequence, we expect the 'start' coordinate to be less than the
    'end'.

    >>> from Bio.SeqFeature import FeatureLocation
    >>> r = FeatureLocation(122, 150, strand=-1)
    >>> print(r)
    [122:150](-)
    >>> print(r.start)
    122
    >>> print(r.end)
    150
    >>> print(r.strand)
    -1

    i.e. Rather than thinking of the 'start' and 'end' biologically in a
    strand aware manner, think of them as the 'left most' or 'minimum'
    boundary, and the 'right most' or 'maximum' boundary of the region
    being described. This is particularly important with compound
    locations describing non-continuous regions.

    In the example above we have used standard exact positions, but there
    are also specialised position objects used to represent fuzzy positions
    as well, for example a GenBank location like complement(<123..150)
    would use a BeforePosition object for the start.
    Nc             C   s#  t  | t  r | |  _ n: t |  r9 t |  |  _ n t d | t |  f   t  | t  rp | |  _ n: t |  r t |  |  _ n t d | t |  f   t  |  j j	 t
  rt  |  j j	 t
  r|  j |  j k rt d j |  j |  j    | |  _ | |  _ | |  _ d S)a  Initialize the class.

        start and end arguments specify the values where the feature begins
        and ends. These can either by any of the ``*Position`` objects that
        inherit from AbstractPosition, or can just be integers specifying the
        position. In the case of integers, the values are assumed to be
        exact and are converted in ExactPosition arguments. This is meant
        to make it easy to deal with non-fuzzy ends.

        i.e. Short form:

        >>> from Bio.SeqFeature import FeatureLocation
        >>> loc = FeatureLocation(5, 10, strand=-1)
        >>> print(loc)
        [5:10](-)

        Explicit form:

        >>> from Bio.SeqFeature import FeatureLocation, ExactPosition
        >>> loc = FeatureLocation(ExactPosition(5), ExactPosition(10), strand=-1)
        >>> print(loc)
        [5:10](-)

        Other fuzzy positions are used similarly,

        >>> from Bio.SeqFeature import FeatureLocation
        >>> from Bio.SeqFeature import BeforePosition, AfterPosition
        >>> loc2 = FeatureLocation(BeforePosition(5), AfterPosition(10), strand=-1)
        >>> print(loc2)
        [<5:>10](-)

        For nucleotide features you will also want to specify the strand,
        use 1 for the forward (plus) strand, -1 for the reverse (negative)
        strand, 0 for stranded but strand unknown (? in GFF3), or None for
        when the strand does not apply (dot in GFF3), e.g. features on
        proteins.

        >>> loc = FeatureLocation(5, 10, strand=+1)
        >>> print(loc)
        [5:10](+)
        >>> print(loc.strand)
        1

        Normally feature locations are given relative to the parent
        sequence you are working with, but an explicit accession can
        be given with the optional ref and db_ref strings:

        >>> loc = FeatureLocation(105172, 108462, ref="AL391218.9", strand=1)
        >>> print(loc)
        AL391218.9[105172:108462](+)
        >>> print(loc.ref)
        AL391218.9

        zstart=%r %sz	end=%r %szFEnd location ({}) must be greater than or equal to start location ({})N)r	   AbstractPosition_startr   ExactPositionr   r   _endstartpositionr@   endr   rB   r   r   r   )r   r_   ra   r   r   r   r   r   r   r     s&    8		zFeatureLocation.__init__c             C   s   |  j  S)z/Get function for the strand property (PRIVATE).)_strand)r   r   r   r   r   3  s    zFeatureLocation._get_strandc             C   s)   | d k r t  d |   | |  _ d S)z/Set function for the strand property (PRIVATE).r9   r   Nz*Strand should be +1, -1, 0 or None, not %rr9   )r9   rc   r   N)r   rb   )r   r   r   r   r   r   7  s    zFeatureLocation._set_strandr   r   r    z+Strand of the location (+1, -1, 0 or None).c             C   s   d |  j  |  j f } |  j rD |  j rD d |  j |  j | f } n |  j rZ |  j | } |  j d k rm | S|  j d k r | d S|  j d	 k r | d S| d Sd S)
a  Return a representation of the FeatureLocation object (with python counting).

        For the simple case this uses the python splicing syntax, [122:150]
        (zero based counting) which GenBank would call 123..150 (one based
        counting).
        z[%s:%s]z%s:%s%sNr9   z(+)z(-)z(?)r9   rc   )r\   r^   r   r   r   )r   r,   r   r   r   r0   C  s    	zFeatureLocation.__str__c             C   s   d } |  j  d k	 r& | d |  j  7} |  j d k	 rF | d |  j 7} |  j d k	 rf | d |  j 7} d |  j j |  j |  j | f S)z?Represent the FeatureLocation object as a string for debugging.r   Nz, strand=%rz, ref=%rz, ref_db=%rz%s(%r, %r%s))r   r   r   r)   r*   r_   ra   )r   optionalr   r   r   r-   Z  s    	zFeatureLocation.__repr__c             C   s@   t  | t  r t |  | g  St |  r8 |  j |  St Sd S)ai  Combine location with another FeatureLocation object, or shift it.

        You can add two feature locations to make a join CompoundLocation:

        >>> from Bio.SeqFeature import FeatureLocation
        >>> f1 = FeatureLocation(5, 10)
        >>> f2 = FeatureLocation(20, 30)
        >>> combined = f1 + f2
        >>> print(combined)
        join{[5:10], [20:30]}

        This is thus equivalent to:

        >>> from Bio.SeqFeature import CompoundLocation
        >>> join = CompoundLocation([f1, f2])
        >>> print(join)
        join{[5:10], [20:30]}

        You can also use sum(...) in this way:

        >>> join = sum([f1, f2])
        >>> print(join)
        join{[5:10], [20:30]}

        Furthermore, you can combine a FeatureLocation with a CompoundLocation
        in this way.

        Separately, adding an integer will give a new FeatureLocation with
        its start and end offset by that amount. For example:

        >>> print(f1)
        [5:10]
        >>> print(f1 + 100)
        [105:110]
        >>> print(200 + f1)
        [205:210]

        This can be useful when editing annotation.
        N)r	   r
   r   r   r1   NotImplemented)r   rX   r   r   r   __add__j  s
    (zFeatureLocation.__add__c             C   s!   t  |  r |  j |  St Sd S)zAAdd a feature locationanother FeatureLocation object to the left.N)r   r1   re   )r   rX   r   r   r   __radd__  s    zFeatureLocation.__radd__c             C   s   d S)a  Return True regardless of the length of the feature.

        This behaviour is for backwards compatibility, since until the
        __len__ method was added, a FeatureLocation always evaluated as True.

        Note that in comparison, Seq objects, strings, lists, etc, will all
        evaluate to False if they have length zero.

        WARNING: The FeatureLocation may in future evaluate to False when its
        length is zero (in order to better match normal python behaviour)!
        Tr   )r   r   r   r   rO     s    zFeatureLocation.__nonzero__c             C   s   t  |  j  t  |  j  S)a{  Return the length of the region described by the FeatureLocation object.

        Note that extra care may be needed for fuzzy locations, e.g.

        >>> from Bio.SeqFeature import FeatureLocation
        >>> from Bio.SeqFeature import BeforePosition, AfterPosition
        >>> loc = FeatureLocation(BeforePosition(5), AfterPosition(10))
        >>> len(loc)
        5
        )r@   r^   r\   )r   r   r   r   rG     s    zFeatureLocation.__len__c             C   sB   t  |  s t d   | |  j k  s6 | |  j k r: d Sd Sd S)a  Check if an integer position is within the FeatureLocation object.

        Note that extra care may be needed for fuzzy locations, e.g.

        >>> from Bio.SeqFeature import FeatureLocation
        >>> from Bio.SeqFeature import BeforePosition, AfterPosition
        >>> loc = FeatureLocation(BeforePosition(5), AfterPosition(10))
        >>> len(loc)
        5
        >>> [i for i in range(15) if i in loc]
        [5, 6, 7, 8, 9]
        zXCurrently we only support checking for integer positions being within a FeatureLocation.FTN)r   r   r\   r^   )r   r   r   r   r   rJ     s    	zFeatureLocation.__contains__c             c   sk   |  j  d k rB xU t |  j d |  j d d  D] } | Vq0 Wn% x" t |  j |  j  D] } | VqX Wd S)a  Iterate over the parent positions within the FeatureLocation object.

        >>> from Bio.SeqFeature import FeatureLocation
        >>> from Bio.SeqFeature import BeforePosition, AfterPosition
        >>> loc = FeatureLocation(BeforePosition(5), AfterPosition(10))
        >>> len(loc)
        5
        >>> for i in loc: print(i)
        5
        6
        7
        8
        9
        >>> list(loc)
        [5, 6, 7, 8, 9]
        >>> [i for i in range(15) if i in loc]
        [5, 6, 7, 8, 9]

        Note this is strand aware:

        >>> loc = FeatureLocation(BeforePosition(5), AfterPosition(10), strand = -1)
        >>> list(loc)
        [9, 8, 7, 6, 5]
        r9   Nrc   rc   )r   ranger^   r\   )r   ir   r   r   rI     s
    'zFeatureLocation.__iter__c             C   sk   t  | t  s d S|  j | j k oj |  j | j k oj |  j | j k oj |  j | j k oj |  j	 | j	 k S)z<Implement equality by comparing all the location attributes.F)
r	   r
   r\   r_   r^   ra   rb   r   r   r   )r   rX   r   r   r   rY     s    zFeatureLocation.__eq__c             C   s   |  | k S)z Implement the not-equal operand.r   )r   rX   r   r   r   rZ     s    zFeatureLocation.__ne__c             C   sR   |  j  s |  j r t d   t d |  j j |  d |  j j |  d |  j  S)zDReturn a copy of the FeatureLocation shifted by an offset (PRIVATE).z$Feature references another sequence.r_   ra   r   )r   r   r   r
   r\   r1   r^   r   )r   r3   r   r   r   r1     s    zFeatureLocation._shiftc             C   s   |  j  s |  j r t d   |  j d k r6 d } n! |  j d k rN d	 } n	 |  j } t d |  j j |  d |  j j |  d |  S)
zEReturn a copy of the location after the parent is reversed (PRIVATE).z$Feature references another sequence.r9   r_   ra   r   r9   rc   rc   r9   )r   r   r   r   r
   r^   r4   r\   )r   r5   Zflip_strandr   r   r   r4     s    			zFeatureLocation._flipc             C   s   |  g S)a.  Read only list of sections (always one, the FeatureLocation object).

        This is a convenience property allowing you to write code handling
        both simple FeatureLocation objects (with one part) and more complex
        CompoundLocation objects (with multiple parts) interchangeably.
        r   )r   r   r   r   parts#  s    zFeatureLocation.partsc             C   s   |  j  S)zStart location - left most (minimum) value, regardless of strand.

        Read only, returns an integer like position object, possibly a fuzzy
        position.
        )r\   )r   r   r   r   r_   -  s    zFeatureLocation.startc             C   s   |  j  S)zEnd location - right most (maximum) value, regardless of strand.

        Read only, returns an integer like position object, possibly a fuzzy
        position.
        )r^   )r   r   r   r   ra   6  s    zFeatureLocation.endc             C   sC   y t  |  j  SWn+ t k
 r> t |  j t  r7 d S  Yn Xd S)zStart position (integer, approximated if fuzzy, read only) (OBSOLETE).

        This is now an alias for int(feature.start), which should be
        used in preference -- unless you are trying to support old
        versions of Biopython.
        N)r@   r\   r   r	   UnknownPosition)r   r   r   r   nofuzzy_start?  s    zFeatureLocation.nofuzzy_startc             C   sC   y t  |  j  SWn+ t k
 r> t |  j t  r7 d S  Yn Xd S)zEnd position (integer, approximated if fuzzy, read only) (OBSOLETE).

        This is now an alias for int(feature.end), which should be
        used in preference -- unless you are trying to support old
        versions of Biopython.
        N)r@   r^   r   r	   rk   )r   r   r   r   nofuzzy_endN  s    zFeatureLocation.nofuzzy_endc             C   s   |  j  s |  j r t d   t | t  r9 | j   } | |  j |  j  } |  j d k r y | j	   } Wn3 t
 k
 r t | t  s t  t	 |  } Yn X| S)a  Extract the sequence from supplied parent sequence using the FeatureLocation object.

        The parent_sequence can be a Seq like object or a string, and will
        generally return an object of the same type. The exception to this is
        a MutableSeq as the parent sequence will return a Seq object.

        >>> from Bio.Seq import Seq
        >>> from Bio.Alphabet import generic_protein
        >>> from Bio.SeqFeature import FeatureLocation
        >>> seq = Seq("MKQHKAMIVALIVICITAVVAAL", generic_protein)
        >>> feature_loc = FeatureLocation(8, 15)
        >>> feature_loc.extract(seq)
        Seq('VALIVIC', ProteinAlphabet())

        z$Feature references another sequence.r9   rc   )r   r   r   r	   r   Ztoseqrl   rm   r   r   r   strAssertionError)r   r7   f_seqr   r   r   r6   ]  s    zFeatureLocation.extract)r*   rK   rL   rM   r   r   r   rN   r   r0   r-   rf   rg   rO   rG   rJ   rI   rY   rZ   r1   r4   rj   r_   ra   rl   rm   r6   r   r   r   r   r
     s4   >Q	0 
		r
   c               @   s`  e  Z d  Z d Z d d d  Z d d   Z d d   Z d	 d
   Z d d   Z e	 d e d e d d  Z
 d d   Z d d   Z d d   Z d d   Z d d   Z d d   Z d d   Z d d    Z d! d"   Z d# d$   Z e	 d% d&    Z e	 d' d(    Z e	 d) d*    Z e	 d+ d,    Z e	 d- d.    Z e	 d/ d0    Z d1 d2   Z d3 S)4r   zBFor handling joins etc where a feature location has several parts.joinc             C   st   | |  _  t |  |  _ x3 |  j D]( } t | t  s" t d | j   q" Wt |  d k  rp t d |   d S)a  Initialize the class.

        >>> from Bio.SeqFeature import FeatureLocation, CompoundLocation
        >>> f1 = FeatureLocation(10, 40, strand=+1)
        >>> f2 = FeatureLocation(50, 59, strand=+1)
        >>> f = CompoundLocation([f1, f2])
        >>> len(f) == len(f1) + len(f2) == 39 == len(list(f))
        True
        >>> print(f.operator)
        join
        >>> 5 in f
        False
        >>> 15 in f
        True
        >>> f.strand
        1

        Notice that the strand of the compound location is computed
        automatically - in the case of mixed strands on the sub-locations
        the overall strand is set to None.

        >>> f = CompoundLocation([FeatureLocation(3, 6, strand=+1),
        ...                       FeatureLocation(10, 13, strand=-1)])
        >>> print(f.strand)
        None
        >>> len(f)
        6
        >>> list(f)
        [3, 4, 5, 12, 11, 10]

        The example above doing list(f) iterates over the coordinates within the
        feature. This allows you to use max and min on the location, to find the
        range covered:

        >>> min(f)
        3
        >>> max(f)
        12

        More generally, you can use the compound location's start and end which
        give the full span covered, 0 <= start <= end <= full sequence length.

        >>> f.start == min(f)
        True
        >>> f.end == max(f) + 1
        True

        This is consistent with the behaviour of the simple FeatureLocation for
        a single region, where again the 'start' and 'end' do not necessarily
        give the biological start and end, but rather the 'minimal' and 'maximal'
        coordinate boundaries.

        Note that adding locations provides a more intuitive method of
        construction:

        >>> f = FeatureLocation(3, 6, strand=+1) + FeatureLocation(10, 13, strand=-1)
        >>> len(f)
        6
        >>> list(f)
        [3, 4, 5, 12, 11, 10]
        zJCompoundLocation should be given a list of FeatureLocation objects, not %sr:   z5CompoundLocation should have at least 2 parts, not %rN)r%   listrj   r	   r
   r   r)   rF   )r   rj   r%   locr   r   r   r     s    >	zCompoundLocation.__init__c             C   s*   d |  j  d j d d   |  j D  f S)zNReturn a representation of the CompoundLocation object (with python counting).z%s{%s}z, c             s   s   |  ] } t  |  Vq d  S)N)rn   ).0rs   r   r   r   	<genexpr>  s    z+CompoundLocation.__str__.<locals>.<genexpr>)r%   rq   rj   )r   r   r   r   r0     s    zCompoundLocation.__str__c             C   s   d |  j  j |  j |  j f S)z>Represent the CompoundLocation object as string for debugging.z
%s(%r, %r))r)   r*   rj   r%   )r   r   r   r   r-     s    zCompoundLocation.__repr__c             C   s8   t  d d   |  j D  d k r0 |  j d j Sd Sd S)z/Get function for the strand property (PRIVATE).c             S   s   h  |  ] } | j   q Sr   )r   )rt   rs   r   r   r   	<setcomp>  s   	 z/CompoundLocation._get_strand.<locals>.<setcomp>r9   r   N)rF   rj   r   )r   r   r   r   r     s    "zCompoundLocation._get_strandc             C   s!   x |  j  D] } | | _ q
 Wd S)z/Set function for the strand property (PRIVATE).N)rj   r   )r   r   rs   r   r   r   r     s    zCompoundLocation._set_strandr   r   r    a  Overall strand of the compound location.

        If all the parts have the same strand, that is returned. Otherwise
        for mixed strands, this returns None.

        >>> from Bio.SeqFeature import FeatureLocation, CompoundLocation
        >>> f1 = FeatureLocation(15, 17, strand=1)
        >>> f2 = FeatureLocation(20, 30, strand=-1)
        >>> f = f1 + f2
        >>> f1.strand
        1
        >>> f2.strand
        -1
        >>> f.strand
        >>> f.strand is None
        True

        If you set the strand of a CompoundLocation, this is applied to
        all the parts - use with caution:

        >>> f.strand = 1
        >>> f1.strand
        1
        >>> f2.strand
        1
        >>> f.strand
        1

        c             C   s   t  | t  r) t |  j | g |  j  St  | t  r |  j | j k rf t d |  j | j f   t |  j | j |  j  St |  r |  j |  St  d S)a  Combine locations, or shift the location by an integer offset.

        >>> from Bio.SeqFeature import FeatureLocation, CompoundLocation
        >>> f1 = FeatureLocation(15, 17) + FeatureLocation(20, 30)
        >>> print(f1)
        join{[15:17], [20:30]}

        You can add another FeatureLocation:

        >>> print(f1 + FeatureLocation(40, 50))
        join{[15:17], [20:30], [40:50]}
        >>> print(FeatureLocation(5, 10) + f1)
        join{[5:10], [15:17], [20:30]}

        You can also add another CompoundLocation:

        >>> f2 = FeatureLocation(40, 50) + FeatureLocation(60, 70)
        >>> print(f2)
        join{[40:50], [60:70]}
        >>> print(f1 + f2)
        join{[15:17], [20:30], [40:50], [60:70]}

        Also, as with the FeatureLocation, adding an integer shifts the
        location's co-ordinates by that offset:

        >>> print(f1 + 100)
        join{[115:117], [120:130]}
        >>> print(200 + f1)
        join{[215:217], [220:230]}
        >>> print(f1 + (-5))
        join{[10:12], [15:25]}
        zMixed operators %s and %sN)	r	   r
   r   rj   r%   r   r   r1   NotImplementedError)r   rX   r   r   r   rf   	  s    !zCompoundLocation.__add__c             C   sL   t  | t  r) t | g |  j |  j  St |  rB |  j |  St  d S)zAdd a feature to the left.N)r	   r
   r   rj   r%   r   r1   rw   )r   rX   r   r   r   rg   8  s
    zCompoundLocation.__radd__c             C   s(   x! |  j  D] } | | k r
 d Sq
 Wd S)zCCheck if an integer position is within the CompoundLocation object.TF)rj   )r   r   rs   r   r   r   rJ   A  s    zCompoundLocation.__contains__c             C   s   d S)a  Return True regardless of the length of the feature.

        This behaviour is for backwards compatibility, since until the
        __len__ method was added, a FeatureLocation always evaluated as True.

        Note that in comparison, Seq objects, strings, lists, etc, will all
        evaluate to False if they have length zero.

        WARNING: The FeatureLocation may in future evaluate to False when its
        length is zero (in order to better match normal python behaviour)!
        Tr   )r   r   r   r   rO   H  s    zCompoundLocation.__nonzero__c             C   s   t  d d   |  j D  S)z1Return the length of the CompoundLocation object.c             s   s   |  ] } t  |  Vq d  S)N)rF   )rt   rs   r   r   r   ru   X  s    z+CompoundLocation.__len__.<locals>.<genexpr>)sumrj   )r   r   r   r   rG   V  s    zCompoundLocation.__len__c             c   s.   x' |  j  D] } x | D] } | Vq Wq
 Wd S)zEIterate over the parent positions within the CompoundLocation object.N)rj   )r   rs   posr   r   r   rI   Z  s    zCompoundLocation.__iter__c             C   s   t  | t  s d St |  j  t | j  k r5 d S|  j | j k rK d Sx3 t |  j | j  D] \ } } | | k ra d Sqa Wd S)zXCheck if all parts of CompoundLocation are equal to all parts of other CompoundLocation.FT)r	   r   rF   rj   r%   zip)r   rX   Z	self_partZ
other_partr   r   r   rY   `  s    "zCompoundLocation.__eq__c             C   s   |  | k S)z Implement the not-equal operand.r   )r   rX   r   r   r   rZ   m  s    zCompoundLocation.__ne__c                s&   t    f d d   |  j D |  j  S)zEReturn a copy of the CompoundLocation shifted by an offset (PRIVATE).c                s   g  |  ] } | j      q Sr   )r1   )rt   rs   )r3   r   r   
<listcomp>u  s   	 z+CompoundLocation._shift.<locals>.<listcomp>)r   rj   r%   )r   r3   r   )r3   r   r1   r  s    zCompoundLocation._shiftc                s&   t    f d d   |  j D |  j  S)a6
  Return a copy of the locations after the parent is reversed (PRIVATE).

        Note that the order of the parts is NOT reversed too. Consider a CDS
        on the forward strand with exons small, medium and large (in length).
        Once we change the frame of reference to the reverse complement strand,
        the start codon is still part of the small exon, and the stop codon
        still part of the large exon - so the part order remains the same!

        Here is an artificial example, were the features map to the two upper
        case regions and the lower case runs of n are not used:

        >>> from Bio.Seq import Seq
        >>> from Bio.SeqFeature import FeatureLocation
        >>> dna = Seq("nnnnnAGCATCCTGCTGTACnnnnnnnnGAGAMTGCCATGCCCCTGGAGTGAnnnnn")
        >>> small = FeatureLocation(5, 20, strand=1)
        >>> large = FeatureLocation(28, 52, strand=1)
        >>> location = small + large
        >>> print(small)
        [5:20](+)
        >>> print(large)
        [28:52](+)
        >>> print(location)
        join{[5:20](+), [28:52](+)}
        >>> for part in location.parts:
        ...     print(len(part))
        ...
        15
        24

        As you can see, this is a silly example where each "exon" is a word:

        >>> print(small.extract(dna).translate())
        SILLY
        >>> print(large.extract(dna).translate())
        EXAMPLE*
        >>> print(location.extract(dna).translate())
        SILLYEXAMPLE*
        >>> for part in location.parts:
        ...     print(part.extract(dna).translate())
        ...
        SILLY
        EXAMPLE*

        Now, let's look at this from the reverse strand frame of reference:

        >>> flipped_dna = dna.reverse_complement()
        >>> flipped_location = location._flip(len(dna))
        >>> print(flipped_location.extract(flipped_dna).translate())
        SILLYEXAMPLE*
        >>> for part in flipped_location.parts:
        ...     print(part.extract(flipped_dna).translate())
        ...
        SILLY
        EXAMPLE*

        The key point here is the first part of the CompoundFeature is still the
        small exon, while the second part is still the large exon:

        >>> for part in flipped_location.parts:
        ...     print(len(part))
        ...
        15
        24
        >>> print(flipped_location)
        join{[37:52](-), [5:29](-)}

        Notice the parts are not reversed. However, there was a bug here in older
        versions of Biopython which would have given join{[5:29](-), [37:52](-)}
        and the translation would have wrongly been "EXAMPLE*SILLY" instead.

        c                s   g  |  ] } | j      q Sr   )r4   )rt   rs   )r5   r   r   r{     s   	 z*CompoundLocation._flip.<locals>.<listcomp>)r   rj   r%   )r   r5   r   )r5   r   r4   x  s    HzCompoundLocation._flipc             C   s   t  d d   |  j D  S)a'  Start location - left most (minimum) value, regardless of strand.

        Read only, returns an integer like position object, possibly a fuzzy
        position.

        For the special case of a CompoundLocation wrapping the origin of a
        circular genome, this will return zero.
        c             s   s   |  ] } | j  Vq d  S)N)r_   )rt   rs   r   r   r   ru     s    z)CompoundLocation.start.<locals>.<genexpr>)minrj   )r   r   r   r   r_     s    
zCompoundLocation.startc             C   s   t  d d   |  j D  S)ag  End location - right most (maximum) value, regardless of strand.

        Read only, returns an integer like position object, possibly a fuzzy
        position.

        For the special case of a CompoundLocation wrapping the origin of
        a circular genome this will match the genome length (minus one
        given how Python counts from zero).
        c             s   s   |  ] } | j  Vq d  S)N)ra   )rt   rs   r   r   r   ru     s    z'CompoundLocation.end.<locals>.<genexpr>)maxrj   )r   r   r   r   ra     s    zCompoundLocation.endc             C   sC   y t  |  j  SWn+ t k
 r> t |  j t  r7 d S  Yn Xd S)zStart position (integer, approximated if fuzzy, read only) (OBSOLETE).

        This is an alias for int(feature.start), which should be used in
        preference -- unless you are trying to support old versions of
        Biopython.
        N)r@   r_   r   r	   rk   )r   r   r   r   rl     s    zCompoundLocation.nofuzzy_startc             C   sC   y t  |  j  SWn+ t k
 r> t |  j t  r7 d S  Yn Xd S)zEnd position (integer, approximated if fuzzy, read only) (OBSOLETE).

        This is an alias for int(feature.end), which should be used in
        preference -- unless you are trying to support old versions of
        Biopython.
        N)r@   ra   r   r	   rk   )r   r   r   r   rm     s    zCompoundLocation.nofuzzy_endc             C   s   d S)zDNot present in CompoundLocation, dummy method for API compatibility.Nr   )r   r   r   r   r     s    zCompoundLocation.refc             C   s   d S)zDNot present in CompoundLocation, dummy method for API compatibility.Nr   )r   r   r   r   r      s    zCompoundLocation.ref_dbc                sO     f d d   |  j  D } | d } x" | d d  D] } | | 7} q7 W| S)a  Extract the sequence from supplied parent sequence using the CompoundLocation object.

        The parent_sequence can be a Seq like object or a string, and will
        generally return an object of the same type. The exception to this is
        a MutableSeq as the parent sequence will return a Seq object.

        >>> from Bio.Seq import Seq
        >>> from Bio.Alphabet import generic_protein
        >>> from Bio.SeqFeature import FeatureLocation, CompoundLocation
        >>> seq = Seq("MKQHKAMIVALIVICITAVVAAL", generic_protein)
        >>> fl1 = FeatureLocation(2, 8)
        >>> fl2 = FeatureLocation(10, 15)
        >>> fl3 = CompoundLocation([fl1,fl2])
        >>> fl3.extract(seq)
        Seq('QHKAMILIVIC', ProteinAlphabet())

        c                s   g  |  ] } | j      q Sr   )r6   )rt   rs   )r7   r   r   r{     s   	 z,CompoundLocation.extract.<locals>.<listcomp>r   r9   N)rj   )r   r7   rj   rp   partr   )r7   r   r6     s
    
zCompoundLocation.extractN)r*   rK   rL   rM   r   r0   r-   r   r   rN   r   rf   rg   rJ   rO   rG   rI   rY   rZ   r1   r4   r_   ra   rl   rm   r   r   r6   r   r   r   r   r   ~  s6   K	/	Lr   c               @   s"   e  Z d  Z d Z d d   Z d S)r[   z,Abstract base class representing a position.c             C   s   d |  j  j S)z@Represent the AbstractPosition object as a string for debugging.z%s(...))r)   r*   )r   r   r   r   r-   #  s    zAbstractPosition.__repr__N)r*   rK   rL   rM   r-   r   r   r   r   r[      s   r[   c               @   sy   e  Z d  Z d Z d d d  Z d d   Z d d   Z e d	 d
    Z e d d    Z	 d d   Z
 d d   Z d S)r]   a  Specify the specific position of a boundary.

    Arguments:
     - position - The position of the boundary.
     - extension - An optional argument which must be zero since we don't
       have an extension. The argument is provided so that the same number
       of arguments can be passed to all position types.

    In this case, there is no fuzziness associated with the position.

    >>> p = ExactPosition(5)
    >>> p
    ExactPosition(5)
    >>> print(p)
    5

    >>> isinstance(p, AbstractPosition)
    True
    >>> isinstance(p, int)
    True

    Integer comparisons and operations should work as expected:

    >>> p == 5
    True
    >>> p < 6
    True
    >>> p <= 5
    True
    >>> p + 10
    15

    r   c             C   s,   | d k r t  d |   t j |  |  S)zCreate an ExactPosition object.r   z)Non-zero extension %s for exact position.)r   r@   __new__)clsr`   	extensionr   r   r   r   K  s    zExactPosition.__new__c             C   s   t  t |    S)zKReturn a representation of the ExactPosition object (with python counting).)rn   r@   )r   r   r   r   r0   T  s    zExactPosition.__str__c             C   s   d |  j  j t |   f S)z=Represent the ExactPosition object as a string for debugging.z%s(%i))r)   r*   r@   )r   r   r   r   r-   X  s    zExactPosition.__repr__c             C   s
   t  |   S)z7Legacy attribute to get position as integer (OBSOLETE).)r@   )r   r   r   r   r`   \  s    zExactPosition.positionc             C   s   d S)z3Not present in this object, return zero (OBSOLETE).r   r   )r   r   r   r   r   a  s    zExactPosition.extensionc             C   s   |  j  t |   |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).)r)   r@   )r   r3   r   r   r   r1   f  s    zExactPosition._shiftc             C   s   |  j  | t |    S)zEReturn a copy of the location after the parent is reversed (PRIVATE).)r)   r@   )r   r5   r   r   r   r4   k  s    zExactPosition._flipN)r*   rK   rL   rM   r   r0   r-   rN   r`   r   r1   r4   r   r   r   r   r]   (  s   !	r]   c               @   s   e  Z d  Z d Z d S)UncertainPositionzSpecify a specific position which is uncertain.

    This is used in UniProt, e.g. ?222 for uncertain position 222, or in the
    XML format explicitly marked as uncertain. Does not apply to GenBank/EMBL.
    N)r*   rK   rL   rM   r   r   r   r   r   q  s   r   c               @   sj   e  Z d  Z d Z d d   Z d d   Z e d d    Z e d d	    Z d
 d   Z	 d d   Z
 d S)rk   zSpecify a specific position which is unknown (has no position).

    This is used in UniProt, e.g. ? or in the XML as unknown.
    c             C   s   d |  j  j S)z?Represent the UnknownPosition object as a string for debugging.z%s())r)   r*   )r   r   r   r   r-     s    zUnknownPosition.__repr__c             C   s
   t  d  S)z4Return the hash value of the UnknownPosition object.N)hash)r   r   r   r   __hash__  s    zUnknownPosition.__hash__c             C   s   d S)z3Legacy attribute to get location (None) (OBSOLETE).Nr   )r   r   r   r   r`     s    zUnknownPosition.positionc             C   s   d S)z?Legacy attribute to get extension (zero) as integer (OBSOLETE).r   r   )r   r   r   r   r     s    zUnknownPosition.extensionc             C   s   |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).r   )r   r3   r   r   r   r1     s    zUnknownPosition._shiftc             C   s   |  S)zEReturn a copy of the location after the parent is reversed (PRIVATE).r   )r   r5   r   r   r   r4     s    zUnknownPosition._flipN)r*   rK   rL   rM   r-   r   rN   r`   r   r1   r4   r   r   r   r   rk   {  s   rk   c               @   s   e  Z d  Z d Z d d   Z d d   Z d d   Z d d	   Z e d
 d    Z	 e d d    Z
 d d   Z d d   Z d S)WithinPositiona  Specify the position of a boundary within some coordinates.

    Arguments:
    - position - The default integer position
    - left - The start (left) position of the boundary
    - right - The end (right) position of the boundary

    This allows dealing with a location like ((1.4)..100). This
    indicates that the start of the sequence is somewhere between 1
    and 4. Since this is a start coordinate, it should acts like
    it is at position 1 (or in Python counting, 0).

    >>> p = WithinPosition(10, 10, 13)
    >>> p
    WithinPosition(10, left=10, right=13)
    >>> print(p)
    (10.13)
    >>> int(p)
    10

    Basic integer comparisons and operations should work as though
    this were a plain integer:

    >>> p == 10
    True
    >>> p in [9, 10, 11]
    True
    >>> p < 11
    True
    >>> p + 10
    20

    >>> isinstance(p, WithinPosition)
    True
    >>> isinstance(p, AbstractPosition)
    True
    >>> isinstance(p, int)
    True

    Note this also applies for comparison to other position objects,
    where again the integer behaviour is used:

    >>> p == 10
    True
    >>> p == ExactPosition(10)
    True
    >>> p == BeforePosition(10)
    True
    >>> p == AfterPosition(10)
    True

    If this were an end point, you would want the position to be 13:

    >>> p2 = WithinPosition(13, 10, 13)
    >>> p2
    WithinPosition(13, left=10, right=13)
    >>> print(p2)
    (10.13)
    >>> int(p2)
    13
    >>> p2 == 13
    True
    >>> p2 == ExactPosition(13)
    True

    The old legacy properties of position and extension give the
    starting/lower/left position as an integer, and the distance
    to the ending/higher/right position as an integer. Note that
    the position object will act like either the left or the right
    end-point depending on how it was created:

    >>> p.position == p2.position == 10
    True
    >>> p.extension == p2.extension == 3
    True
    >>> int(p) == int(p2)
    False
    >>> p == 10
    True
    >>> p2 == 13
    True

    c             C   sY   | | k p | | k s1 t  d | | | f   t j |  |  } | | _ | | _ | S)zCreate a WithinPosition object.z3WithinPosition: %r should match left %r or right %r)RuntimeErrorr@   r   _left_right)r   r`   leftrightobjr   r   r   r     s    		zWithinPosition.__new__c             C   s   t  |   |  j |  j f S)zzReturn the arguments accepted by __new__.

        Necessary to allow pickling and unpickling of class instances.
        )r@   r   r   )r   r   r   r   __getnewargs__  s    zWithinPosition.__getnewargs__c             C   s&   d |  j  j t |   |  j |  j f S)z>Represent the WithinPosition object as a string for debugging.z%s(%i, left=%i, right=%i))r)   r*   r@   r   r   )r   r   r   r   r-     s
    		zWithinPosition.__repr__c             C   s   d |  j  |  j f S)zLReturn a representation of the WithinPosition object (with python counting).z(%s.%s))r   r   )r   r   r   r   r0     s    zWithinPosition.__str__c             C   s   |  j  S)z>Legacy attribute to get (left) position as integer (OBSOLETE).)r   )r   r   r   r   r`     s    zWithinPosition.positionc             C   s   |  j  |  j S)zPLegacy attribute to get extension (from left to right) as an integer (OBSOLETE).)r   r   )r   r   r   r   r     s    zWithinPosition.extensionc             C   s+   |  j  t |   | |  j | |  j |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).)r)   r@   r   r   )r   r3   r   r   r   r1     s    zWithinPosition._shiftc             C   s+   |  j  | t |   | |  j | |  j  S)zEReturn a copy of the location after the parent is reversed (PRIVATE).)r)   r@   r   r   )r   r5   r   r   r   r4   !  s    zWithinPosition._flipN)r*   rK   rL   rM   r   r   r-   r0   rN   r`   r   r1   r4   r   r   r   r   r     s   S	r   c               @   s   e  Z d  Z d Z d d   Z d d   Z d d   Z d d	   Z e d
 d    Z	 e d d    Z
 d d   Z d d   Z d S)BetweenPositionaV  Specify the position of a boundary between two coordinates (OBSOLETE?).

    Arguments:
     - position - The default integer position
     - left - The start (left) position of the boundary
     - right - The end (right) position of the boundary

    This allows dealing with a position like 123^456. This
    indicates that the start of the sequence is somewhere between
    123 and 456. It is up to the parser to set the position argument
    to either boundary point (depending on if this is being used as
    a start or end of the feature). For example as a feature end:

    >>> p = BetweenPosition(456, 123, 456)
    >>> p
    BetweenPosition(456, left=123, right=456)
    >>> print(p)
    (123^456)
    >>> int(p)
    456

    Integer equality and comparison use the given position,

    >>> p == 456
    True
    >>> p in [455, 456, 457]
    True
    >>> p > 300
    True

    The old legacy properties of position and extension give the
    starting/lower/left position as an integer, and the distance
    to the ending/higher/right position as an integer. Note that
    the position object will act like either the left or the right
    end-point depending on how it was created:

    >>> p2 = BetweenPosition(123, left=123, right=456)
    >>> p.position == p2.position == 123
    True
    >>> p.extension
    333
    >>> p2.extension
    333
    >>> p.extension == p2.extension == 333
    True
    >>> int(p) == int(p2)
    False
    >>> p == 456
    True
    >>> p2 == 123
    True

    Note this potentially surprising behaviour:

    >>> BetweenPosition(123, left=123, right=456) == ExactPosition(123)
    True
    >>> BetweenPosition(123, left=123, right=456) == BeforePosition(123)
    True
    >>> BetweenPosition(123, left=123, right=456) == AfterPosition(123)
    True

    i.e. For equality (and sorting) the position objects behave like
    integers.

    c             C   sF   | | k s | | k s t   t j |  |  } | | _ | | _ | S)z0Create a new instance in BetweenPosition object.)ro   r@   r   r   r   )r   r`   r   r   r   r   r   r   r   k  s
    		zBetweenPosition.__new__c             C   s   t  |   |  j |  j f S)zzReturn the arguments accepted by __new__.

        Necessary to allow pickling and unpickling of class instances.
        )r@   r   r   )r   r   r   r   r   s  s    zBetweenPosition.__getnewargs__c             C   s&   d |  j  j t |   |  j |  j f S)z?Represent the BetweenPosition object as a string for debugging.z%s(%i, left=%i, right=%i))r)   r*   r@   r   r   )r   r   r   r   r-   z  s
    		zBetweenPosition.__repr__c             C   s   d |  j  |  j f S)zMReturn a representation of the BetweenPosition object (with python counting).z(%s^%s))r   r   )r   r   r   r   r0     s    zBetweenPosition.__str__c             C   s   |  j  S)z>Legacy attribute to get (left) position as integer (OBSOLETE).)r   )r   r   r   r   r`     s    zBetweenPosition.positionc             C   s   |  j  |  j S)zPLegacy attribute to get extension (from left to right) as an integer (OBSOLETE).)r   r   )r   r   r   r   r     s    zBetweenPosition.extensionc             C   s+   |  j  t |   | |  j | |  j |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).)r)   r@   r   r   )r   r3   r   r   r   r1     s    zBetweenPosition._shiftc             C   s+   |  j  | t |   | |  j | |  j  S)zEReturn a copy of the location after the parent is reversed (PRIVATE).)r)   r@   r   r   )r   r5   r   r   r   r4     s    zBetweenPosition._flipN)r*   rK   rL   rM   r   r   r-   r0   rN   r`   r   r1   r4   r   r   r   r   r   (  s   A	r   c               @   sy   e  Z d  Z d Z d d d  Z e d d    Z e d d    Z d	 d
   Z d d   Z	 d d   Z
 d d   Z d S)BeforePositiona9  Specify a position where the actual location occurs before it.

    Arguments:
     - position - The upper boundary of where the location can occur.
     - extension - An optional argument which must be zero since we don't
       have an extension. The argument is provided so that the same number
       of arguments can be passed to all position types.

    This is used to specify positions like (<10..100) where the location
    occurs somewhere before position 10.

    >>> p = BeforePosition(5)
    >>> p
    BeforePosition(5)
    >>> print(p)
    <5
    >>> int(p)
    5
    >>> p + 10
    15

    Note this potentially surprising behaviour:

    >>> p == ExactPosition(5)
    True
    >>> p == AfterPosition(5)
    True

    Just remember that for equality and sorting the position objects act
    like integers.
    r   c             C   s,   | d k r t  d |   t j |  |  S)z/Create a new instance in BeforePosition object.r   z)Non-zero extension %s for exact position.)r   r@   r   )r   r`   r   r   r   r   r     s    zBeforePosition.__new__c             C   s
   t  |   S)z7Legacy attribute to get position as integer (OBSOLETE).)r@   )r   r   r   r   r`     s    zBeforePosition.positionc             C   s   d S)z?Legacy attribute to get extension (zero) as integer (OBSOLETE).r   r   )r   r   r   r   r     s    zBeforePosition.extensionc             C   s   d |  j  j t |   f S)z1Represent the location as a string for debugging.z%s(%i))r)   r*   r@   )r   r   r   r   r-     s    zBeforePosition.__repr__c             C   s   d |  j  S)zLReturn a representation of the BeforePosition object (with python counting).z<%s)r`   )r   r   r   r   r0     s    zBeforePosition.__str__c             C   s   |  j  t |   |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).)r)   r@   )r   r3   r   r   r   r1     s    zBeforePosition._shiftc             C   s   t  | t |    S)zEReturn a copy of the location after the parent is reversed (PRIVATE).)AfterPositionr@   )r   r5   r   r   r   r4     s    zBeforePosition._flipN)r*   rK   rL   rM   r   rN   r`   r   r-   r0   r1   r4   r   r   r   r   r     s   r   c               @   sy   e  Z d  Z d Z d d d  Z e d d    Z e d d    Z d	 d
   Z d d   Z	 d d   Z
 d d   Z d S)r   a  Specify a position where the actual location is found after it.

    Arguments:
     - position - The lower boundary of where the location can occur.
     - extension - An optional argument which must be zero since we don't
       have an extension. The argument is provided so that the same number
       of arguments can be passed to all position types.

    This is used to specify positions like (>10..100) where the location
    occurs somewhere after position 10.

    >>> p = AfterPosition(7)
    >>> p
    AfterPosition(7)
    >>> print(p)
    >7
    >>> int(p)
    7
    >>> p + 10
    17

    >>> isinstance(p, AfterPosition)
    True
    >>> isinstance(p, AbstractPosition)
    True
    >>> isinstance(p, int)
    True

    Note this potentially surprising behaviour:

    >>> p == ExactPosition(7)
    True
    >>> p == BeforePosition(7)
    True

    Just remember that for equality and sorting the position objects act
    like integers.
    r   c             C   s,   | d k r t  d |   t j |  |  S)z2Create a new instance of the AfterPosition object.r   z)Non-zero extension %s for exact position.)r   r@   r   )r   r`   r   r   r   r   r     s    zAfterPosition.__new__c             C   s
   t  |   S)z7Legacy attribute to get position as integer (OBSOLETE).)r@   )r   r   r   r   r`     s    zAfterPosition.positionc             C   s   d S)z?Legacy attribute to get extension (zero) as integer (OBSOLETE).r   r   )r   r   r   r   r     s    zAfterPosition.extensionc             C   s   d |  j  j t |   f S)z1Represent the location as a string for debugging.z%s(%i))r)   r*   r@   )r   r   r   r   r-     s    zAfterPosition.__repr__c             C   s   d |  j  S)zKReturn a representation of the AfterPosition object (with python counting).z>%s)r`   )r   r   r   r   r0   "  s    zAfterPosition.__str__c             C   s   |  j  t |   |  S)zIReturn a copy of the position object with its location shifted (PRIVATE).)r)   r@   )r   r3   r   r   r   r1   &  s    zAfterPosition._shiftc             C   s   t  | t |    S)zEReturn a copy of the location after the parent is reversed (PRIVATE).)r   r@   )r   r5   r   r   r   r4   *  s    zAfterPosition._flipN)r*   rK   rL   rM   r   rN   r`   r   r-   r0   r1   r4   r   r   r   r   r     s   &r   c               @   s   e  Z d  Z d Z d d   Z d d   Z e d d    Z e d d	    Z d
 d   Z	 d d   Z
 d d   Z d d   Z d S)OneOfPositionaV  Specify a position where the location can be multiple positions.

    This models the GenBank 'one-of(1888,1901)' function, and tries
    to make this fit within the Biopython Position models. If this was
    a start position it should act like 1888, but as an end position 1901.

    >>> p = OneOfPosition(1888, [ExactPosition(1888), ExactPosition(1901)])
    >>> p
    OneOfPosition(1888, choices=[ExactPosition(1888), ExactPosition(1901)])
    >>> int(p)
    1888

    Interget comparisons and operators act like using int(p),

    >>> p == 1888
    True
    >>> p <= 1888
    True
    >>> p > 1888
    False
    >>> p + 100
    1988

    >>> isinstance(p, OneOfPosition)
    True
    >>> isinstance(p, AbstractPosition)
    True
    >>> isinstance(p, int)
    True

    The old legacy properties of position and extension give the
    starting/lowest/left-most position as an integer, and the
    distance to the ending/highest/right-most position as an integer.
    Note that the position object will act like one of the list of
    possible locations depending on how it was created:

    >>> p2 = OneOfPosition(1901, [ExactPosition(1888), ExactPosition(1901)])
    >>> p.position == p2.position == 1888
    True
    >>> p.extension == p2.extension == 13
    True
    >>> int(p) == int(p2)
    False
    >>> p == 1888
    True
    >>> p2 == 1901
    True

    c             C   sA   | | k r" t  d | | f   t j |  |  } | | _ | S)zInitialize with a set of possible positions.

        position_list is a list of AbstractPosition derived objects,
        specifying possible locations.

        position is an integer specifying the default behaviour.
        z(OneOfPosition: %r should match one of %r)r   r@   r   position_choices)r   r`   choicesr   r   r   r   r   b  s    	zOneOfPosition.__new__c             C   s   t  |   |  j f S)zzReturn the arguments accepted by __new__.

        Necessary to allow pickling and unpickling of class instances.
        )r@   r   )r   r   r   r   r   r  s    zOneOfPosition.__getnewargs__c             C   s   t  d d   |  j D  S)z>Legacy attribute to get (left) position as integer (OBSOLETE).c             s   s   |  ] } t  |  Vq d  S)N)r@   )rt   ry   r   r   r   ru   |  s    z)OneOfPosition.position.<locals>.<genexpr>)r|   r   )r   r   r   r   r`   y  s    zOneOfPosition.positionc             C   s*   d d   |  j  D } t |  t |  S)z8Legacy attribute to get extension as integer (OBSOLETE).c             S   s   g  |  ] } t  |   q Sr   )r@   )rt   ry   r   r   r   r{     s   	 z+OneOfPosition.extension.<locals>.<listcomp>)r   r}   r|   )r   Z	positionsr   r   r   r   ~  s    zOneOfPosition.extensionc             C   s    d |  j  j t |   |  j f S)z=Represent the OneOfPosition object as a string for debugging.z%s(%i, choices=%r))r)   r*   r@   r   )r   r   r   r   r-     s    		zOneOfPosition.__repr__c             C   s:   d } x |  j  D] } | d | 7} q W| d d  d S)zKReturn a representation of the OneOfPosition object (with python counting).zone-of(z%s,Nr9   r(   rc   )r   )r   r/   r`   r   r   r   r0     s    zOneOfPosition.__str__c                s0   |  j  t |       f d d   |  j D  S)zIReturn a copy of the position object with its location shifted (PRIVATE).c                s   g  |  ] } | j      q Sr   )r1   )rt   p)r3   r   r   r{     s   	 z(OneOfPosition._shift.<locals>.<listcomp>)r)   r@   r   )r   r3   r   )r3   r   r1     s    zOneOfPosition._shiftc                s=   |  j    t |     f d d   |  j d d d  D  S)zEReturn a copy of the location after the parent is reversed (PRIVATE).c                s   g  |  ] } | j      q Sr   )r4   )rt   r   )r5   r   r   r{     s   	 z'OneOfPosition._flip.<locals>.<listcomp>Nr9   rc   )r)   r@   r   )r   r5   r   )r5   r   r4     s    zOneOfPosition._flipN)r*   rK   rL   rM   r   r   rN   r`   r   r-   r0   r1   r4   r   r   r   r   r   /  s   1r   c               @   s:   e  Z d  Z d Z d d   Z d d   Z d d   Z d S)	PositionGapz?Simple class to hold information about a gap between positions.c             C   s   | |  _  d S)z@Intialize with a position object containing the gap information.N)gap_size)r   r   r   r   r   r     s    zPositionGap.__init__c             C   s   d |  j  j t |  j  f S)z5Represent the position gap as a string for debugging.z%s(%s))r)   r*   r+   r   )r   r   r   r   r-     s    zPositionGap.__repr__c             C   s   d |  j  S)zIReturn a representation of the PositionGap object (with python counting).zgap(%s))r   )r   r   r   r   r0     s    zPositionGap.__str__N)r*   rK   rL   rM   r   r-   r0   r   r   r   r   r     s   r   __main__)run_doctestN)rM   
__future__r   collectionsr   Z	Bio._py3kr   ZBio.Seqr   r   objectr   rP   r
   r   r[   r@   r]   r   rk   r   r   r   r   r   r   r*   Z
Bio._utilsr   r   r   r   r   <module>4   s2     J  I
!vELr