| |
Sequin Help Documentation |
| Sequin | Entrez | BLAST | OMIM | Taxonomy | Structure |
 
>Seq1 [organism=Mus musculus] [strain=C57BL/6] Mus musculus neuropilin 1 (Nrp1) mRNA, complete cds.
>ABCD [organism=Plasmodium falciparum] [isolate=ABCD] Plasmodium falciparum isolate ABCD merozoite surface protein 2 (msp2) gene, partial cds.
>DNA.new [organism=Homo sapiens] [chromosome=17] [map=17q21] [moltype=mRNA] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.#The line after the FASTA definition line begins the nucleotide sequence. Unlike the FASTA definition line, the nucleotide sequence itself can contain returns. It is recommended that each line of sequence be no longer than 80 characters. Please only use IUPAC symbols within the nucleotide sequence. For sequences that are not contained within an alignment, do not use "?" or "-" characters. These will be stripped from the sequence. Use the IUPAC approved symbol "N" for ambiguous characters instead. #A single file containing multiple FASTA sequences can be imported into Sequin in order to create a Batch Submission . Make sure that the FASTA definition line for each sequence is formatted as above. #If the FASTA definition line is not properly formatted a pop-up box will appear upon importing the nucleotide FASTA. The top box in this pop-up will list any errors in the FASTA definition lines, including missing SeqIDs, duplicate SeqIDs for different sequences, or improperly formatted modifiers. You can add or edit this information in the spreadsheet provided. The toggle at the bottom of the pop-up allows you to select whether all sequences or only those with errors are listed in the spreadsheet above. After making changes, click on Refresh Error List to ensure that all errors have been corrected. You must correct any errors involving the SeqID in order to proceed with your submission. *FASTA Format for Gapped Sequence #The FASTA definition line for a gapped sequence follows the same format as above. To indicate a gap within the sequence, enter a hard return within the sequence at the point of the gap, then insert an extra line starting with a carat (">") and a question mark ("?"). If the gap size is unknown, enter "unk100" after the question mark. If the gap size is known, enter the length of the gap after the question mark. For example, !>Dobi [organism=Canis familiaris] [breed=Doberman pinscher] !AAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTA !GGAAAAAGGGCTGTTG !>?unk100 !TGGATGACAGAAACCTTGTTGGTCCAAAATGCAAACCCAGATKGTAAGACCATTTTAAAAGCATTGGGTC !TTAGAAATAGGGCAACACAGAACAAAAAT !>?234 !AAAAATAAAAGCATTAGTAGAAATTTGTACAGAACTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCT !GAAAACCCATACAATACTCCGGG will generate a sequence containing two gaps. The first gap is of unknown length, the second is 234 nucleotides long. *FASTA+GAP Format for Aligned Nucleotide Sequences #A number of programs output sets of aligned sequences in FASTA format. Frequently, to align these sequences, gaps must be inserted. The default alignment settings should correctly interpret gap and ambiguous characters in most cases. If Sequin can not read your alignment, you may need to change these settings using the Optional Alignment Settings button on the Nucleotide Page form. Each sequence, including gaps, must be the same length. The gaps will only show up in the alignment, not in the individual sequence in the database. #Sequences in FASTA+GAP format resemble FASTA sequences. The previous section on FASTA Format for Nucleotide Sequences has instructions for formatting FASTA sequences. If one of the sequences in your alignment is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new Accession number. To do this, use a SeqID in the format accU12345, where U12345 is the Accession number of the pre-existing sequence. All sequences in FASTA+GAP format should be in the same file. #The following is an example of FASTA+GAP format: !>A-0V-1-A [organism=Gallus gallus] [clone=C] !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-2-A [organism=Drosophila melanogaster] [strain=D] !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-3-A [organism=Caenorhabditis elegans] [strain=E] !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-4-A [organism=Rattus norvegicus] [strain=F] !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-7-A [organism=Aspergillus nidulans] [strain=G] !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT *PHYLIP Format for Aligned Nucleotide Sequences #A number of programs output sets of aligned sequences in PHYLIP format. #The following is an example of PHYLIP format. ! 5 100 !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA ! ! ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT #In this example, the first line indicates that there are 5 sequences, each with 100 nt of sequence. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence do not contain the Sequence ID. If one of the sequences in your alignment is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new Accession number. To do this, use a SeqID in the format accU12345, where U12345 is the Accession number of the pre-existing sequence. #The default alignment settings should correctly interpret gap and ambiguous characters in most cases. If Sequin can not read your alignment, you may need to change these settings using the Optional Alignment Settings button on the Nucleotide Page form. #You can modify the PHYLIP format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . #Alternatively, you can leave your sequence alignment in standard PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . *NEXUS Format for Aligned Nucleotide Sequences #A number of programs output sets of aligned sequences in one of two NEXUS formats, NEXUS Interleaved and NEXUS Contiguous. #NEXUS files can contain ? for "missing" at the 5' and 3' ends of sequences, as long as this parameter is properly defined within the header of the NEXUS file. #The following is an example of NEXUS Interleaved format. !#NEXUS ! !begin data; ! dimensions ntax=5 nchar=100; ! format datatype=dna missing=? gap=- interleave; ! matrix ! !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA T????ATAGA GGGGCAACTA !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA ! ! !A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT #In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID. If one of the sequences in your alignment is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new Accession number. To do this, use a SeqID in the format accU12345, where U12345 is the Accession number of the pre-existing sequence. Also, Sequin will replace the "?" characters in the sequences with "N"s since they are defined as "missing" data in the header. The default alignment settings should correctly interpret gap and ambiguous characters in most cases. If Sequin can not read your alignment, you may need to change these settings using the Optional Alignment Settings button on the Nucleotide Page form. #You can modify either NEXUS format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . #Alternatively, you can leave your sequence alignment in standard NEXUS format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . #The following is an example of NEXUS Contiguous format. !#NEXUS !BEGIN DATA; !DIMENSIONS NTAX=5 NCHAR=100; !FORMAT MISSING=? GAP=- DATATYPE=DNA ; !MATRIX ! !A-0V-1-A !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-2-A !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-3-A !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-4-A !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-7-A !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT #In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID. If one of the sequences in your alignment is already present in the GenBank/EMBL/D DBJ database, you must mark that sequence so that it does not receive a new Accession number. To do this, use a SeqID in the format accU12345, where U12345 is the Accession number of the pre-existing sequence. #You can modify either NEXUS format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . #Alternatively, you can leave your sequence alignment in standard NEXUS format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . **Source Modifiers for PHYLIP and NEXUS #You can modify the PHYLIP or NEXUS formats so that Sequin can determine the correct organism and any other modifiers for each sequence by adding lines at the end of the file. The first line applies to the first sequence, the second line to the second sequence, and so on. You must have one line for each sequence. These inserted lines contain modifiers formatted like in the FASTA definition line, but do not begin with a SeqID. Instead, the SeqID is present at the beginning of the sequence lines as shown above. #Each of the initial lines starts with the character ">". The scientific organism name follows in brackets. Optional modifiers also follow in brackets. For further information on the data that can go in the lines preceding the sequences, see the instructions entitled "FASTA Format for Nucleotide Sequences", above. #The following lines indicating the organisms and strain of each sequence would follow immediately after the sequence in the PHYLIP and NEXUS examples, above. !; !END; ! !begin ncbi; !sequin !>[organism=Gallus gallus] [clone=C] !>[organism=Drosophila melanogaster] [strain=D] !>[organism=Caenorhabditis elegans] [strain=E] !>[organism=Rattus norvegicus] [strain=F] !>[organism=Aspergillus nidulans] [strain=G] !; !end; #The number of lines of source information must exactly match the number of sequences provided. Complete examples can be found in the Alignment Formats section of the Sequin Quick Guide. #Alternatively, you can leave your sequence alignment in standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Organism Page . >Nucleotide Page #The options on this page will vary depending on the Submission Type and Sequence Data Format selected earlier. Gapped sequences must be imported as properly formatted FASTA files. Details about importing alignment files are below . *Nucleotide Page for FASTA Data Format **Create Alignment #If you have selected a Population study, Phylogenetic study, Mutation study, or Environmental samples set as a Submission Type a check box will appear at the top of the Nucleotide Page. If you check 'Create Alignment', Sequin will attempt to generate an alignment of the sequences within your submission. Alignments are not required for these types of submissions however. **Import Nucleotide FASTA #Use this button to import your properly formatted FASTA file . You will see a window containing information about the imported sequence(s). Please check the number of sequences, Sequence IDs (SeqIDs) and length of each sequence to make sure they are correct. If you have included source information within the FASTA definition line, this will also be listed. If the sequences contain a significant number of ambiguous bases near the 5' or 3' end, you may be prompted to trim or remove these sequences from your submission. **Add/Modify Sequences #This option allows you to add or modify sequences without using a previously formatted FASTA file, but is not available if you have selected a gapped sequence as a Submission Type . On the Specify Sequences box you can either import a nucleotide FASTA or add a new sequence. If you choose Add New Sequence, a new box will pop-up where you can either import an existing sequence file or directly paste or type the nucleotide sequence. If the sequences contain a significant number of ambiguous bases near the 5' or 3' end, you may be prompted to trim or remove these sequences from your submission. #If you add a sequence where the FASTA definition line is not properly formatted a pop-up box will appear. The top box in this pop-up will list any errors in the FASTA definition lines, including missing SeqIDs, duplicate SeqIDs for different sequences, or improperly formatted modifiers. You can add or edit this information in the spreadsheet provided. The toggle at the bottom of the pop-up allows you to select whether all sequences or only those with errors are listed in the spreadsheet above. After making changes, click on Refresh Error List to ensure that all errors have been corrected. You must correct any errors involving the SeqID in order to proceed with your submission. Click on Accept to save your sequences and return to the Specify Sequences box. #In the Specify Sequences box, you can choose to add another sequence or select a sequence from the list and choose to edit or delete it. You can also delete all sequences at this point. You will need to click on Done to save your sequences and return to the Nucleotide Page. **Clear Sequences #This option will remove all imported nucleotide sequences. **Specify Molecule #A database sequence can represent one of several different molecule types. The default molecule is genomic DNA. If the sequence was not derived from genomic DNA, you can edit that information here. If you are submitting multiple sequences you can apply one molecule type to all sequences or apply the molecule type to each sequence individually. Enter in the Molecule pop-up menu the type of molecule that was sequenced. #-Genomic DNA: Sequence derived directly from the DNA of an organism. Note: The DNA sequence of an rRNA gene has this molecule type, as does that from a naturally-occurring plasmid. #-Genomic RNA: Sequence derived directly from the genomic RNA of certain organisms, such as viruses. #-Precursor RNA: An RNA transcript before it is processed into mRNA, rRNA, tRNA, or other cellular RNA species. #-mRNA[cDNA]: A cDNA sequence derived from mRNA. #-Ribosomal RNA: A sequence derived from the RNA in ribosomes. This should only be selected if the RNA itself was isolated and sequenced. If the gene for the ribosomal RNA was sequence, select Genomic DNA. #-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for example, the sequence of a cDNA derived from tRNA. #-Other-Genetic: A synthetically derived sequence including cloning vectors and tagged fusion constructs. #-cRNA: A sequence derived from complementary RNA transcribed from DNA, mainly used for viral submissions. #-Transcribed RNA: A sequence derived from any transcribed RNA not listed above. #-Tranfer-messenger RNA: A sequence derived from transfer-messenger RNA, which acts as a tRNA first and then an mRNA that encodes a peptide tag. If the gene for the tmRNA was sequenced, use genomic DNA. #-ncRNA: A sequence derived from other non-coding RNA not specified #above. If the gene for the ncRNA was sequenced, select Genomic DNA. **Specify Topology #Most sequences have a Linear topology and this is the default. You should change this setting to Circular only if the sequence is complete and it has a circular topology. For example, a complete plasmid or a complete mitochondrial genome would have a Circular topology, but a single gene from a plasmid or mitochondrion would have a Linear topology. If you are submitting multiple sequences you can apply one topology to all sequences or set the topology for each sequence individually. **Vector Trim Tool # Please use this tool to detect and remove vector contamination from sequences before submitting. The Vector Trim tool runs a BLAST search of your sequence(s) against NCBI's UniVec database. If potential contamination is found, a new window will be launched. The left side of the window lists the sequences with vector matches. These are grouped by 5' End, Internal, or 3' End. The level of the match, ie suspect, weak, moderate or strong is also listed. If you click on one of the matches, the corresponding nucletoide location of the match is listed on the right side of the window. The Make Report button at the bottom of the window will generate a pop-up containing the match results. From the pop-up you can Export the report using the File menu. #You can trim the imported sequence(s) by clicking on the check boxes beside the match results or using the Select All or Select Only Strong and Moderate buttons at the bottom of the window. Once you have selected sequence to be trimmed, use the Trim Selected Sequences button at the bottom of the window. A pop-up box will appear with the nucleotide locations that have been removed from the imported sequence(s). *Nucleotide Page for Aligned Data Formats **Import Nucleotide Alignment #Once you have imported the alignment using the Import Nucleotide Alignment button, you can edit the molecule information using the Specify Molecule and Specify Topology buttons explained above. Note that you can not access the Add/Modify Sequences dialog for submissions of aligned sequences. If the alignment contains sequences with a significant number of ambiguous bases near the 5' or 3' end, you may be prompted to trim or remove these sequences from your file. **Optional Alignment Settings #If you are submitting a set of aligned sequences, you can specify sequence characters used in your alignment here. In most cases, the default settings do not need to be changed. #Every sequence within an alignment file must contain the same number of characters (nucleotides + gaps). Gap characters are used to represent the spaces between contiguous nucleotides in an alignment. Gaps that appear at the beginning or end of a sequence are treated differently than gaps that appear between nucleotides and each must be defined. GenBank prefers to use a hyphen (-) to represent gaps. If you use a different character to represent a gap, you will need to add this character to the list in the Beginning Gap, Middle Gap, or End Gap boxes. #Ambiguous characters represent nucleotides that are known to exist, but whose identity has not been experimentally validated. GenBank prefers to use 'n' to represent any ambiguous nucleotides. If you are using a different character to represent an ambiguous base, you will need to add this character to the list in the Ambiguous/Unknown box. Sequin will convert these characters to 'n's when your file is imported. #Match characters denote nucleotides that are identical in every member of an alignment. GenBank prefers the use of a colon (:) to represent match characters. If you are using a different character to represent a match character, you will need to add this character to the list in the Match box. >Sequencing Method Page #If you are submitting over 500 sequences or your sequences were generated using next-generation sequencing technology, the information in this form is required. Use the check boxes at the top of the form to select the sequencing technology type(s) used to obtain the sequences. Multiple types can be selected, if appropriate. If you used technology that is not listed in the form, please select other and use the free text box to provide the information. After selecting the sequencing technology, select the radio button to indicate if your sequences are raw sequence reads or sequence assemblies. If you are submitting assemblies using next-generation sequencing technology, the name of the assembly program and program version or date the assemblies were made are required in the free text boxes. If multiple assembly programs were used, Click on Add More Assembly Programs and complete the provided spreadsheet. Raw sequence reads from next generation sequencing technologies should be submitted to SRA . >Organism Page #Information about the organism from which the sequence was derived should be entered or edited on this page. If there are any potential problems with the organism information previously provided in either the FASTA definition line or entered in the Add/Modify Sequences dialog, a window listing these problems will appear at the top of the form. Please review these problems and edit using the Add Source Modifiers button as necessary. At minimum, you must supply the scientific name of the organism from which the sequence was obtained in order to proceed with your submission. #The second window is a summary of the organism information provided so far. Double clicking on a line of text within this window will launch a modifier-specific editing window. In each of these windows, you can edit the available information for the specific modifier. In most cases, you have the choice to edit the modifier for each sequence separately, or to enter text and select Apply above value to all sequences. These changes will be reflected in the windows of the Organism page immediately upon closing the modifier-specific editor. *Add Organisms, Locations, and Genetic Codes #If you have not added organism information using either the FASTA definition line or the Add/Modify Sequences dialog, you can use the Add Organisms, Locations, and Genetic Codes to do so at this point. This button will launch the Multiple Organism Editor pop-up where you may add or edit existing information concerning the Organism name, Location and Genetic Code . The SeqID of each sequence is listed at the left of the spreadsheet format. You can change the information in the spreadsheet individually or globally for all sequences. **Organism #The scrollable list at the top of the pop-up contains the scientific names of many organisms. To reach a name on the list, type the first few letters of the scientific name into the box above the list or the appropriate box in the spreadsheet. The list will scroll to the names beginning with those letters, and you can select the organism within the list itself. You can then use the arrow button to copy this name into the appropriate box in the spreadsheet. #To apply the same scientific name to all sequences in the submission, click on the Organism button in the spreadsheet column header. A separate pop-up box will appear with the same organism list. You can select a name from this list and choose Accept to apply this name to all sequences. #If you have any questions about the scientific name of an organism, see the NCBI Taxonomy Browser http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/ #If the name of the organism is not on the list, type it in directly. If you do not know the scientific name, please be as specific as you can and include a unique identifier, such as a clone, isolate, strain or voucher number, or cultivar name, e.g.; Nostoc ATCC29106, uncultured spirochete Im403, Lauraceae sp. Vásquez 25230 (MO), Rosa hybrid cultivar 'Kazanlik'. Also, if applicable, indicate if the name is unpublished as of the time of submission. Additional information such as strain, isolate, or serotype can be entered later in the submission process. **Location #The default Location for all sequences is "Genomic". If the sequence is not genomic, select the alternative location (ie, organelle) from the pull-down list. You can change the location of all sequences globally by clicking on the Location button in the spreadsheet header. The following is a brief description of the choices in this list: #-Apicoplast: a reduced plastid characteristic of apicomplexans (e.g., Plasmodium). NOTE: apicoplast should be applied ONLY to members of the Apicomplexa. #-Chloroplast: a chlorophyllous plastid. #-Chromatophore: a membrane-bound vesicle containing photosynthetic pigments in bacteria. #-Chromoplast: a non-chlorophyllous, pigmented plastid, found in fruits and flowers. #-Cyanelle: a specialized type of plastid found exclusively in glaucocystophytes (e.g., Cyanophora). NOTE: cyanelle should be applied ONLY to members of the Glaucocystophyceae. #-Endogenous_virus: a virus that has integrated permanently into the host genome, and which is inherited vertically through the germline of the host. #-Extrachromosomal: other extrachromosomal elements not listed here, such as a B chromosome or an F factor. #-Genomic: chromosome. This category includes mitochondrial and chloroplast proteins that are encoded by the nuclear genome. #-Hydrogenosome: an organelle that produces hydrogen and ATP and is found mainly in ciliates, fungi and trichomonads. Hydrogenosomes may be reduced mitochondria. #-Kinetoplast: a specialized type of mitochondrion found exclusively in Kinetoplastida (e.g., Leishmania). NOTE: kinetoplast should be applied ONLY to members of the Kinetoplastida (trypanosomes and bodonids). #-Leucoplast: a plastid lacking pigments of any type. #-Macronuclear: a specialized type of nucleus found exclusively in the ciliated protists (e.g., Tetrahymena). NOTE: macronucleus should be applied ONLY to members of the Ciliophora. #-Mitochondrion: a semi-autonomous, self-reproducing organelle that occurs in the cytoplasm of most eukaryotic cells. #-Nucleomorph: a reduced nuclear remnant found in Chlorarachniophyceae (e.g., Chlorarachnion) and Cryptophyta (e.g, Cryptomonas). NOTE: nucleomorph should be applied ONLY to members of the Chlorarachniophyceae or Cryptophyta. #-Plasmid: extrachromosomal genetic element found in bacterial species. Note this does not include the cloning vector used to propagate the sequence of interest. #-Plastid: any of a class of double membrane-bound, light-harvesting organelles (or derived from same). NOTE: plastid should be used ONLY when a more precise term, e.g., chloroplast, is not applicable. #-Proplastid: an immature plastid. #-Proviral: a virus that is integrated into a host cell chromosome. **Genetic Code #If you selected a scientific organism name from the scrollable list described above, this field will be filled out automatically. However, if the organism is not on the list, this field will default to the "Standard" genetic code. If this is incorrect, you can select the correct genetic code from the pull-down list. To globally change the genetic code for all sequences which are not automatically filled out, click on the Genetic Code button in the spreadsheet header. #For more information regarding the genetic codes available, see the NCBI Taxonomy page . http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=cgencodes *Import Source Modifiers #Using this button allows you to import a tab-delimited table of source modifiers. The first column in the table must contain the Sequence Identifiers (SeqIDs) used earlier in the submission and each subsequent column must contain a different source modifier. The first row in the table must contain the labels for each column. The label for the Sequence Identifiers column should be in the format "Seq_ID". A list of modifiers in the format to be used in the column headers is available. *Add Source Modifiers #Using this button will launch the Specify Source Modifiers pop-up box where you can add or edit any source modifier. You can also import a source modifier table or export the existing source modifiers in table format from this page. #The Select Modifier dialog allows you to select a modifier from the pull-down list and edit the value of this modifier for each sequence or globally add a value to all sequences. #The two windows in this pop-up provide information about the current source modifiers for the sequences in your submission. The top window provides a summary of these modifiers and the lower window lists the values of each modifier for each sequence. If any sequences have missing organism names or have source information that is identical to another sequence, the SeqIDs will be shown in red in this window. Double-clicking on a modifier value in this window will launch a pop-up where you can edit this value. Double-clicking on the modifier name used in the header will launch a modifier-specific pop-up where you can globally edit the modifier value for all sequences or change the value for individual sequences. *Clear All Source Modifiers #This button will clear all modifiers previously entered in either the FASTA definition lines or the submission dialogs. This includes the organism name which is required for submission. >Protein Page #This page allows you to provide the protein sequence translated from the nucleotide sequence that you just entered. If the nucleotide sequence is alternatively spliced or contains multiple open reading frames, enter all of the protein sequences on this page. Each protein sequence will appear in the database record as a coding sequence (CDS) feature. Sequin will automatically determine which nucleotide sequences code for the protein and indicate the nucleotide sequence interval on the database record. Sequin also provides tools that allow you to view a graphical representation of all the open reading frames in your nucleotide sequence and to convert these reading frames into CDS features. These tools are described later in the help documentation under the ORF Finder. *Incomplete at NH3 end/Incomplete at COOH end #If the sequence is lacking amino acids at the amino- or carboxy-terminal end of the protein, please check the appropriate box. *Create Initial mRNA with CDS Intervals #If you check this box, Sequin will make an mRNA feature with the same initial intervals (i.e., range of sequence) as the CDS feature. After the record has been assembled, you should edit the mRNA feature location to add the 5' UTR and 3' UTR intervals. This may be done either in the mRNA editor or in the sequence editor. *Import Protein FASTA #You can import a single or multiple protein sequences contained within a previously generated protein FASTA file. **FASTA Format for Protein Sequences #The basic FASTA format is the same as that used for nucleotide sequences , with a FASTA definition line followed by the sequence itself. #In order to match the protein sequence to the correct nucleotide sequence, you must use the same Sequence Identifier (SeqID) that you used to identify the nucleotide sequence. Thus in cases of alternatively spliced genes, a single protein FASTA file can contain two unique sequences that have the same SeqID. Both coding regions will be added to the same nucleotide sequence. #The available modifiers for use in a protein FASTA definition line are different than those for a nucleotide FASTA definition line and are limited to information about the protein or gene itself and are contained within the examples below. The format remains [modifer=text]. #Note in all cases, the FASTA definition line must not contain any hard returns. All information must be on a single line of text. #Examples of properly formatted protein FASTA definition lines are:
>Seq1 [protein=neuropilin 1] [gene=Nrp1]
>ABCD [protein=merozoite surface protein 2] [gene=msp2] [protein_desc=MSP2]
>DNA.new [protein=breast and ovarian cancer susceptibility protein] [gene=BRCA1]#The protein name should be included in the entry; all other fields are optional. #The line after the FASTA definition line begins the amino acid sequence. It is recommended that each line of sequence be no longer than 80 characters. Please only use IUPAC symbols within the amino acid sequence. Non-IUPAC amino acid symbols will be stripped from the sequence. #After you import your sequence, a window will appear with information about the sequence. The first line will describe the number of protein sequences imported and the total length in amino acids of all sequences. Each sequence is numbered, and its length, unique identifier (SeqID), Gene symbol, Protein name, and title (Definition line) as supplied in the FASTA definition line are listed. >Annotation Page #Note: This page will not be available if you have selected a gapped sequence as the Submission Type . #On this page, you can add a CDS , gene or ribosomal RNA feature across the entire span of each sequence you are submitting. You can not specify locations within each sequence using this page. In order to add a CDS feature, you must enter a protein name. If the sequence represents a gene that codes for a protein, you must enter a CDS and not just a gene. More options are available under the Annotate Menu in the record viewer. #If the feature should be partial at one or both ends, check the appropriate box and then fill in the text boxes for the relevant feature. You can also select whether the feature is on the Plus or Minus strand. #You may add a title to all sequences if this was not included in the FASTA definition line. This will be used as the DEFINITION field in the final flatfile. The title should contain a brief description of the sequence. >Assembly Tracking #You will only see this form if you had previously indicated that the entry is a Third-Party Annotation submission. You must provide the GenBank Accession number(s) of the primary sequence used to assemble your TPA sequence. We can not accept primary sequences corresponding to Reference Sequences or those from proprietary databases. More information about this can be found on the TPA home page. #If a proper GenBank Accession is entered in the first column of the Assembly Tracking form, the GenBank staff can map the coordinates for you. You do not need to fill out the 'from' and 'to' columns. Note that multiple accessions may be entered to provide full coverage of the assembled sequence. #If the accession entered is not recognized as a GenBank Accession number, a pop-up box is generated requesting that you edit the numbers listed. Sequences from the trace archive can be used primary sequence data for TPA records but must be entered in the format "TI123456789". #You may also generate an Assembly Tracking form in the record viewer under the Annotate menu. Select Descriptors and TPA Assembly from the pull-down menu in order to generate the Assembly Tracking form. >Editing the Record *Overview #After you finish the Organism and Sequences Form, Sequin will process your entry based on the information you have entered. The window you see now is called the record viewer. #In the default window of the record viewer, you will see your entry approximately as it would appear in the database. Most of the information that you entered earlier in the submission process is present in the viewer; other information, such as the contact, is still present in the record but will not be visible in the database entry. If you have provided a conceptual translation of the nucleotide sequence, the translation will be listed as a CDS Feature. Sequin automatically determines which nucleotides encode for the protein, and lists them, even if the nucleotide sequence contains introns and exons. #You can save the entry to a file by selecting Save or Save As under the File menu. This is not the same as saving the entry for submission to the database. It is a good idea to save the file at this point so that if you make any unwanted changes during the editing process you can revert to the original copy. If you wish to edit the entry later, click on "Read Existing Record" on the Welcome to Sequin form and choose the file. #It is likely that the entry could be processed now for submission to the database. However, you may wish to add information to the entry. This information may be in the form of Descriptors or Features. Descriptors are annotations that apply to an entire sequence, or an entire set of sequences, and Features are annotations that apply to a specific sequence interval. For example, you may want to change the Reference Descriptor to add a published manuscript, or to annotate the sequence by adding features such as a signal peptide. #Information in the record viewer can be edited in different ways. One way to modify information is to double click within the block of information you wish to edit. Many blocks, such as "Definition", "Source", "Reference", or "Features" can be edited. #To add information, create a new descriptor or feature by selecting the appropriate form from the Misc or Features menus. These options are described later in this help document. #Finally, you may need to edit the sequence itself. Instructions for working with the sequence are presented in the documentation for the Sequence Editor. *Submitting the Finished Record to the Database #Once you are satisfied that you have added all the appropriate information, you must process your entry for submission to the database. Select "Validate" under the Search menu. This function detects discrepancies between the format of your submission and that required by the database selected for entry. #If Sequin detects problems with the format of your record, you will see a screen listing the validation errors as well as suggestions for how to fix the discrepancies. Single clicking on an error message scrolls the record viewer to the feature that is causing the error. Double clicking on the error message launches the relevant feature editor on which you can correct the problem. If you are annotating a set of multiple sequences, shift-click to scroll to the target sequence and feature. When you think you have corrected all the problems, click on "Revalidate". You can submit files with errors, but it is strongly recommended that you correct as many errors as possible prior to submission. #Message: Select Verbose, Normal, Terse, or Table. Verbose gives a more detailed explanation of the problem. #Filter: Select the error messages you wish to see. You can select ALL, SEQ_INST (errors regarding the sequence itself, its type, or length), SEQ_DESCR (descriptor errors), SEQ_FEAT (feature errors), or errors specific to your record. #Severity: Select the types of error messages you wish to see. You will see the type of message selected, as well as any messages warning of more serious problems. #There are four types of error messages, Info, Warning, Error, and Reject. Info is the least severe, and Reject is the most severe. You may submit the record even if it does contain errors. However, we encourage you to fix as many problems as possible. Note that some messages may be merely suggestions, not discrepancies. A possible Warning message is that a splice site does not match the consensus. This may be a legitimate result, but you may wish to recheck the sequence. A possible Error message is that the conceptual translation of the sequence that you supplied does not encode an open reading frame. In this case, you should check that you translated the sequence in the correct reading frame. A possible Reject message is that you neglected to include the name of the organism from which the sequence was derived. The name of the organism is absolutely required for a database entry. #If Sequin does not detect any problems with the format of your record, you will see a message that "Validation test succeeded". #To prepare the submission, click the "Done" button on the record viewer, or select "Prepare Submission" under the File menu. You will be prompted to save the file. Email this file to the database at the address shown. You MUST email the file; Sequin does not submit the file automatically over the network. databases are: #After your entry is complete, close the record viewer. You will be returned to the Welcome to Sequin form and can begin another entry. >The Record Viewer *Target Sequence #This pop-up menu shows a list of SeqIDs of all nucleotide and protein sequences associated with the Sequin entry. Use the menu to select the sequences displayed in the record viewer, as well as the sequences you want to "target", that is, the sequences to which you want to apply a descriptor (see Descriptors in the Sequin help documentation). You may select either an individual sequence by name or a set of sequences, such as All Sequences, or SEG_dna if you have a segmented nucleotide set. You may change the selection at any time. *Display Format #You may change the display format of the record viewer to any of the formats described below. Editing a field in one display format will change that field in all formats. Subsequent pop-up menus will appear depending on which format is selected. **GenBank #This display format allows you to see the submission as it would appear as a GenBank or DDBJ entry. It is the default format. #The Mode pop-up default setting is Sequin. Release mode shows certain qualifiers and db_xrefs in RefSeq entries which are non-collaborative. Entrez mode is used for web display and can show new elements that have not yet finished their four month quarentine period. Dump mode requires that the accession slot be populated. In most cases, there is no need to change from the default Sequin mode. #The Style pop-up allows different views of segmented records. The default is Normal. Segment style is the traditional representation of segmented sequences, while Contig style displays a CONTIG line with a join of accessions instead of raw sequence. Master style shows features mapped to the segmented sequence coordinates instead of the coordinates of the individual parts. **Graphic #This display format shows the entry in a graphical view. The top bar represents the nucleotide sequence. Lower arrows or bars represent different features on the sequence. Double click on an arrow or bar to launch the appropriate editing window. Any sequence highlighted in the Sequence Editor will be boxed on the graphical view of the sequence. To see a graphical representation of a segmented set (see Submission type , above), the Target Sequence must be set to SEG_dna. #The Style pop-up menu allows you to see the display in different styles and colors. #The Scale pop-up menu allows you to see the display in different sizes. The smaller the number, the larger the display. **Sequence #This display format shows the nucleotide sequence in the record along with any annotated features (such as CDS or mRNA). You can only view a single sequence at a time with this option. You can use the Features pop-up menu to change the display of the features. With the numbering pop-up menu, select where you want the sequence numbers to be indicated, at the side of the window, at the top of each sequence line, or not at all. **Alignment #This display format shows sets of aligned sequences, such as those imported as part of a population, phylogenetic, mutation, or environmental samples set. When toggled to All Sequences in the Target Sequence pop-up, the alignment of all entries will be displayed. To more closely analyze similarities, you can select a single entry in the Target Sequence pop-up. The complete sequence of the entry selected will be displayed. Any nucleotides in the other sequences that differ from that selected will be displayed, while identical nucleotides will be displayed as a period. You can also display features annotated on the selected target sequence or all sequences using the Feature display toggle. To launch the alignment editor, select Alignment Assistant from the record viewer Edit menu. **EMBL #This display format allows you to see the submission as it would appear as an EMBL entry. **Table #This display format shows the annotation in a five-column, tab-delimited table format. This format can be imported to add annotation to a record that has none. **FASTA #This display shows the sequence and Definition line only, without any annotations, in a format called the FASTA format. This is a format used by many molecular biology analysis programs. You cannot edit in this display mode. **Quality #This display format shows quality score data ifit has been included in the submission. **ASN.1 #This display shows the entry in Abstract Syntax Notation 1, a data description language used by the NCBI. You cannot edit in this display mode. **XML #This display format shows the entry in XML language, sometimes used by various databases. You cannot edit in this display mode. **INSDSeq #This display format shows the entry in the XML format used by the INSD. You cannot edit in this display mode. **Desktop #The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu. *Done #This button allows you to validate the entry when you are finished with the submission. See Submitting the Finished Record to the Database in the Sequin help documentation. *Controls for Downloaded Entries #If you have downloaded a sequence from Entrez, you will see an additional button labeled PubMed. This button will launch a web browser containing the target sequence as it appears in Entrez. From here, you can access any Entrez-supported Links, including related sequences and associated references in PubMed. >Descriptors *Descriptor Overview #Descriptors are annotations that apply to an entire sequence, or an entire set of sequences, in a given entry. They do not have a specific location on a sequence, as they apply to the entire sequence. They can be contrasted to Features, which apply to a specific interval of the sequence. #You may edit descriptors in one of two ways. #(1) In the record viewer, double click within the text of the descriptor to bring up a form on which information can be added. #(2) Choose the option Descriptors from the Annotate menu. *Annotate Menu - Descriptors #This menu allows you either to create new descriptors or to modify existing ones. Select the descriptor that you wish to modify. #When you first select a descriptor, you will see a window called "Descriptor Target Control". Using the target control pop-up menu, select the sequences you wish this descriptor to cover. The name(s) listed correspond to the SeqID(s) given to the nucleotide or amino acid sequences when they were imported into Sequin. The default selection for this menu is set in the Target Sequence pop-up menu on the record viewer. You may choose to have the descriptor cover just one sequence, or a set of sequences in your entry. If you are creating a new descriptor, select "Create New". If you wish to modify a previous descriptor, select "Edit Old". #The following is a list of some of the descriptors that can be added. Two additional descriptors, those for Publications and Biological Source, are described in other sections. **TPA Assembly #If you indicated that your sequence is a TPA submission, a TPA Assembly was created from the information regarding primary accession numbers. This Assembly information can be edited here. Note that it is not necessary to enter nucleotide location in the "from" and "to" columns. **Comment #This descriptor is used to list any additional information that you wish to provide about the sequence. Use of this descriptor is optional. Most information can be better annotated using the appropriate features and qualifiers rather than a generic comment descriptor. **Title #This descriptor contains the information that will go on the Definition line of the database entry. If you supplied a title for your nucleotide sequence when you imported it into Sequin, that information is here. If you wish to change the Definition line, or if you did not supply a title when you submitted the sequence, edit this Descriptor. Note that nucleotide definition lines follow a standard format and may be changed by the staff when your submission is processed. **Molecule Description #This descriptor indicates the characteristics of the molecule from which the sequence was derived. The information that you have already entered can be edited here. In most cases, the molecule and class are the only choices which should be edited from the default values. ***Molecule #A GenBank sequence can represent one of several different molecule types. Enter in the Molecule pop-up menu the type of molecule that was sequenced. A brief description of the choices in this pop-up menu were listed previously. ***Completedness Choose the appropriate option from the pop-up menu. #-Complete: Use this designation when a complete molecule, such as a complete mitochondrial genome, is being submitted. #-Partial: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, is being submitted. #-No left: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted. The sequence has no left if it is incomplete on the 5', or amino-terminal, end. #-No right: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted. The sequence has no right if it is incomplete on the 3', or carboxy-terminal, end. #-No ends: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted, The sequence has no ends if it is incomplete at both the 5' and 3', or amino- and carboxy- terminal, ends. #-Other: Use this designation when none of the above descriptions apply. ***Technique #From the pop-up menu, select the technique that was used to generate the sequence. #-Standard: standard sequencing technique. #-EST: Expressed Sequence Tag : single-pass, low-quality mRNA sequences derived from cDNAs. These sequences will appear in the EST division. #-STS: Sequence Tagged Site : short sequences that are operationally unique in a genome and that define a specific position on the physical map. These sequences will appear in the STS division. #-Survey: single-pass genomic sequence . These sequences will appear in the Genome Survey Sequence (GSS) division. #-Genetic Map: Genetic map information, for example, in the Genomes division. #-Physical Map: Physical map information, for example in the Genomes division. #-Derived: A sequence assembled into a contig from shorter sequences. #-Concept-trans: A protein translation generated with the appropriate genetic code. #-Seq-pept: Protein sequence was generated by direct sequencing of a peptide. #-Both: Protein sequence was generated by conceptual translation and confirmed by peptide sequencing. #-Seq-pept-Overlap: Protein sequence was generated by sequencing multiple peptides, and the order of peptides was determined by overlap in their sequences. #-Seq-pept-Homol: Protein sequence was generated by sequencing multiple peptides, and the order of peptides was determined by homology with another protein. #-Concept-Trans-A: Conceptual translation of the nucleotide sequence provided by the author of the entry. #-HTGS 0: High Throughput Genome Sequence , Phase 0. These sequences are produced by high-throughput sequencing projects and will be in the HTG division. #-HTGS 1: High Throughput Genome Sequence , Phase 1. These sequences are produced by high-throughput sequencing projects and will be in the HTG division. #-HTGS 2: High Throughput Genome Sequence , Phase 2. These sequences are produced by high-throughput sequencing projects and will be in the HTG division. #-HTGS 3: High Throughput Genome Sequence , Phase 3. These sequences are produced by high-throughput sequencing projects and will be in the HTG division. #-FLI_cDNA: Full Length Insert cDNA. Sequence corresponds to entire cDNA but not necessarily entire transcript. These sequences are produced by large sequencing projects. #-HTC: High Throughput cDNA. These sequences are produced by large sequencing projects. #-WGS: Whole Genome Shotgun . These sequences are produced by large sequencing projets and follow a separate submission process. #-Barcode: Nucleotide sequence is part of Barcodes of Life project. This selection should only be used by members of the Consortium for the Barcodes of Life. #-Composite-WGS-HTGS: Nucleotide sequence has been assembled by large sequencing centers using a combination of whole genome shotgun and BAC-baed sequencing. #-TSA: Transcriptome Shotgun Assembly. Shotgun assemblies of mRNA sequences from primary data submitted to dbEST, the short read archive (SRA) or the trace archive. #-Other: Do not use this designation. ***Class #From the pop-up menu, select the type of molecule that was sequenced. #-DNA: DNA #-RNA: RNA #-Protein: Protein #-Nucleotide: Do not select this item #-Other: Do not select this item ***Topology #From the pop-up menu, select the topology of the sequenced molecule. #-Linear: Linear molecule (most sequences). #-Circular: Circular molecule (such as a complete plasmid or mitochondrion). #-Tandem: Do not select this item. #-Other: Do not select this item. ***Strand #From the pop-up menu, select whether the sequence was derived from an organism with a single- or double-stranded genome. This is used primarily for viral submissions. #-Single: The organism contains only a single-stranded genome, for example, ssRNA viruses. #-Double: The organism contains only a double-stranded genome, for example, dsDNA viruses. #-Mixed: Do not select this item. #-Mixed Rev: Do not select this item. #-Other: Do not select this item. **Biological Source #The Biological Source descriptor is described in more detail below. >Features *Feature Overview #Features are annotations which apply to one or more intervals on a sequence. They can be contrasted to Descriptors, that apply to an entire sequence or an entire set of sequences. Features will be added to the Target Sequence selected in the record viewer pop-up menu. #You may add or modify features in one of three ways. #(1) In the record viewer, double click on the text of an existing feature to bring up a form on which information can be added or edited. #(2) Choose the feature from the Annotate menu to add a new feature. #(3) Choose the feature from the Sequence Editor Features menu to add a new feature. #The features listed in the Annotate menu and the Sequence Editor Features menu are identical, and the instructions for adding them are the same, with one exception. If you annotate them in the Annotate menu, you must provide the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you can highlight the sequence that the feature covers, and the location of the sequence will be automatically entered in the feature location box. *Annotate Menu - Features #This menu allows you to add or modify features on the sequence selected in the Target Sequence pop-up menu of the record viewer. Features are grouped into six categories. Select the feature that you would like to mark on your sequence. A new form will appear. #Feature forms share a common design. The first page is specific to the particular feature, e.g., Coding Region or Gene. The second page lists Properties of the Feature. The third page describes the Location of the feature. Details about the common second and third pages are provided below. **Properties Page ***General Subpage #Enter general comments about the feature here. #Select any of the flags if necessary. If the annotated feature corresponds to a pseudogene, you must select a type from the pull-down. The individual types are taken from the INSDC controlled vocabulary: processed (arisen by reverse transcription of mRNA into cDNA, followed by reintegration into the genome), unprocessed (arisen from a copy of the parent gene by duplication followed by accumulation of random mutations), unitary (pseudogene is original gene which is functional in some species but disrupted in some way), allelic (unitary pseduogene that is stable in the population but has functional alternative allele), unknown (method of pseudogenization is unknown). Check the "Exception" box if the feature annotates a post-transcriptional modification of the nucleotide sequence, such as ribosomal slippage or RNA editing. This is generally used only on CDS features. The evidence dialogs will only be editable if information has been entered in the Evidence subpage. #If a gene feature overlaps the feature you are editing, the gene symbol will appear in the pull-down menu. If you want to add the name of a new gene, select new, and enter its name and optional description. By default, mapping between the feature and the gene is done by overlap, that is, the gene associated with the feature is the gene whose location overlaps with the location of the feature. Under some circumstances, for example, if the sequences of two genes overlap, you may wish the feature to apply to a different gene. In this case, select cross-reference, and select the name of the new gene in the pop-up menu. If you do not want the feature to map to any existing gene, select suppress. You may also edit information on the Gene feature form by clicking on Edit Gene Feature. ***Comment Subpage #Add any comments about the feature here, especially if you checked the "Exception" box on the General Subpage. ***Citations Subpage #This page is used to list any citations that specifically apply to the feature you are annotating. The citation must have already been entered into the record (see Publications ) in the Sequin help documentation. Click on Edit Citations, and place a check mark in box next to the publication you want to cite. However, we discourage the use of citations on features. ***Cross-Refs Subpage #This is a read-only page used to cross-reference this entry to entries in external databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as dbEST or FLYBASE. For more information on this topic, see the International Nucleotide Sequence Database Collaboration page . http://www.ncbi.nlm.nih.gov/collab/db_xref.html ***Evidence Subpage #This page is primarily used by large sequencing centers to explain annotation prediction methods and its use is optional. More details about these qualifiers can be found in the genome submission guidelines . The two choices of evidence are Experiment or Inference. #Wet-bench, experimental evidence can be entered as free text in the Experiment section. Please be as brief as possible. The Category pull-down is optional and describes what the experiment has determined (coordinates, description or existence). The experiment itself is defined in the middle box. A supporting PMID ID or doi can be entered in the final box. #The Inference section allows for information to be added in cases where the feature is annotated based solely on sequence similarity or prediction software. In order to fill in text, you must select one of the options from the Type pull-down menu. The Category field is optional and indicates which category of data is inferred. Different pull-down and text boxes will appear depending on the selection you choose from the Type menu. If you select one of the 'similar to' categories, you must include the name of the database and the corresponding accession number of the sequence used as the basis for the annotation. If you choose one of the prediction categories, you must include the name and version of the prediction program used as the basis for the annotation. #For example, if your annotation of a coding region was based on similarity to the sequence and annotation in GenBank Accession number AY411252, you would select "similar to DNA sequence" from the pull-down menu and then select "INSD" in the Database pull-down. You would then type "AY411252.1" in the Accession text box. If the annotation is based on the Genscan prediction algorithm, you would select "ab initio prediction" from the pull-down menu, select "Genscan" in the Program pull-down and enter 2.0 in the Program Version text box. If the database or program used is not listed in the appropriate pull-down list, select Other from the list. A new text box will appear where you can enter the name of the database or program used. You still must include the appropriate accession number or version in the subsequent text box. ***Identifiers Subpage #This is a read-only page used by the database staff for tracking features within the record. **Location Page #This page allows you to select the location of the feature you are citing. Each feature must have a sequence interval associated with it. In most cases, Sequin will limit the option to the nucleic acid or protein sequence as appropriate. #Check the 5' Partial or 3' Partial box if the feature in your nucleic acid sequence is missing residues at the 5' or 3' ends, respectively. Check the NH2 Partial or COOH Partial if the feature in your amino acid sequence is missing residues at the amino- or carboxy-terminal ends, respectively. If you checked "Partial" on the Properties page, you must check either the 5' and/or 3' partial boxes. #Enter the sequence range of the feature. The numbers should correspond to the nucleotide sequence interval if the SeqID is set to a nucleotide sequence, and to an amino acid sequence interval if the SeqID is set to a protein sequence. If the feature spans multiple, non-continuous intervals on the sequence, indicate the beginning and end points of each interval. If each interval is separate, and should not be joined with the others to describe the feature, check the Intersperse intervals with gaps box (for example, when annotating multiple primer binding sites). If the feature is composed of several intervals that should all be joined together, do not check the box (for example, when annotating mRNA on a genomic DNA sequence). #For nucleic acid Features only: From the pop-up menu, select the strand on which the feature is found. #-Plus: Plus strand, or coding strand. #-Minus: Minus strand, or non-coding strand. #-Both: Both strands. #-Reverse: Do not select this item. #-Other: Do not select this item. #Use the pop-up menu to select the SeqID of the sequence you are describing by the location. Clicking on the X button to the left will clear location spans, strand, and SeqID from that row. #If you are working on a set of sequences which contain an alignment, you will see a toggle at the bottom of the Location Page where you can select to add or view the location of the feature using the Sequence Coordinates of the target sequence or the Alignment Coordinates. In either case, the feature will only be added to the target sequence. If you want to add features to all members of the set using the alignment coordinates, you must use the Alignment Assistant . #A brief description of the available features follows. A detailed explanation of how to use the coding region (CDS) feature is included. The DDBJ/EMBL/GenBank feature table definition page http://www.ncbi.nlm.nih.gov/collab/FT/index.html provides detailed information about other features. *C_region #Constant region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Includes one or more exons, depending on the particular chain. *CDS #coding sequence; sequence of nucleotides that corresponds with the sequence of amino acids in a protein (location includes stop codon). Feature includes amino acid conceptual translation. **Coding Region Page #Most users add a coding region to their sequence when they fill out the Organism and Sequences form. However, you may need to edit the coding region, or add additional ones. Choose CDS under the Coding Regions and Transcripts submenu of the Features menu, or to edit an existing CDS, double click on the record viewer. If you appended the partial sequence of a coding region to the Organism and Sequences form, you will probably need to edit the Coding Region feature to avoid validation error messages about the location of the coding region. ***General (Product) Subpage #Choose the genetic code that should be used to translate the nucleotide sequence. For more information, and for the translation tables themselves, see the NCBI Taxonomy page . If the genetic code is already populated from the taxonomy database, do not change this selection. #Choose the reading frame in which to translate the sequence. Do not fill in the Protein Product or SeqID selections. #Supply additional information about the protein by clicking on Edit Protein Information to launch the Protein feature forms. The protein name must have already been filled out on the Protein subpage. #If you have changed the nucleotide location spans of the coding region, check Update mRNA Span on Accept. This will adjust the mRNA feature locations as well. #Checking retranslate on accept will translate the nucleotide sequence according to the interval(s) indicated on the Locations page when you click on Accept to exit the editor. This new translation will replace any earlier translations you have supplied. This should not be a problem if the interval was indicated appropriately. #If the coding sequence that you supply is a partial sequence and you have checked a Partial box on the Location subpage, it is a good idea to check the Synchronize Partials box. In this case, Sequin will ensure that all other appropriate features (such as protein) are also marked as partial. #When editing existing CDS features, choose the sequence you want to view by selecting its name uder the Product pop-up menu. You may also import a new protein sequence by selecting Import Protein FASTA under the file menu. The sequence should be formatted as described above on the Organism and Sequences form. #After you have imported a protein sequence, click on Predict Interval. This function will predict the interval on the nucleotide sequence to which the coding region applies. If you do not select this function, the interval will likely be wrong, and you will get an error message when you attempt to validate the record. If your sequence is a 5' or 3' partial, you must first indicate this manually on the Location Page. #You may also have Sequin generate the protein sequence from the nucleotide sequence by clicking on Translate Product. However, you must first indicate the location and partialness of the coding region on the Location page in order to obtain the correct translation. #The Edit Protein Sequence button will launch an amino acid Sequence Editor as discussed below. #The Adjust for Stop Codon button will truncate a displayed translation at the first stop codon. If no stop codon is present in the current translation, this function will extend the translation to the first stop codon or to the end of the sequence. In both cases, the spans of the coding region will be automatically updated on the Location Page to reflect the new translation. ***Protein Subpage #Use this page to enter or edit a name or description of the protein product. For a new sequence, enter information directly into the boxes. You can edit descriptions of an existing sequence by clicking on Edit Protein Feature which will bring up the Protein feature form. The Launch Product Viewer displays the flatfile view of ht eprotein record generated from the information in the CDS feature. ***Exceptions Subpage #Exceptions describe places where there is a posttranslational modification. Enter the amino acid position at which the modification occurs, and select the amino acid that is actually represented in the protein from the pop-up list. Sequin will change the amino acid number to a nucleotide interval. Please provide some explanation for the exception in a comment. *centromere #Region of chromosome to which spindle traction fibers attach during mitosis and meiosis. Must be experimentally characterized. *D-loop #Displacement loop; a region within mitochondrial DNA in which a short stretch of RNA is paired with one strand of DNA, displacing the original partner DNA strand in this region; also used to describe the displacement of a region of one strand of duplex DNA by a single stranded invader in the reaction catalyzed by RecA protein. *D_segment #Diversity segment of immunoglobulin heavy chain, and T-cell receptor beta chain. *exon #Region of genome that codes for portion of spliced mRNA; may contain 5' UTR, all CDSs, and 3' UTR. *gene #Region of biological interest identified as a gene and for which a name has been assigned. *iDNA #Intervening DNA; DNA which is eliminated through any of several kinds of recombination. *intron #A segment of DNA that is transcribed, but removed from within the transcript, by splicing together the sequences (exons) on either side of it. *J_segment #Joining segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. *mat_peptide #Mature peptide or protein coding sequence; coding sequence for the mature or final peptide or protein product following post-translational modification. The location does not include the stop codon (unlike the corresponding CDS). *misc_binding #Site in nucleic acid that covalently or non-covalently binds another moiety that cannot be described by any other Binding key (primer_bind or protein_bind). *misc_difference #Feature sequence is different from that presented in the entry and cannot be described by any other Difference key (unsure, mutation, variation, or modified_base). *misc_feature #Region of biological interest which cannot be described by any other feature key. *misc_recomb #Site of any generalized, site-specific, or replicative recombination event where there is a breakage and reunion of duplex DNA that cannot be described by other recombination keys (iDNA and virion) or qualifiers of source key (/proviral). *misc_RNA #Any transcript or RNA product that cannot be defined by other RNA keys (prim_transcript, precursor_RNA, mRNA, 5'UTR, 3'UTR, exon, transit_peptide, polyA_site, rRNA, tRNA, and ncRNA). *misc_structure #Any secondary or tertiary structure or conformation that cannot be described by other Structure keys (stem_loop and D-loop). *mobile_element #Region of genome containing an element capable of or derived from movement from one location to another in the genome. The mobile_element_type qualifier is mandatory and a pull-down menu lists approved types. The name of the specific element can be given in the text box. *modified_base #The indicated nucleotide is a modified nucleotide and should be substituted for by the indicated molecule (given in the mod_base qualifier value). *mRNA #messenger RNA; includes 5' untranslated region (5' UTR), coding sequences (CDS, exon) and 3' untranslated region (3' UTR). *ncRNA #non-coding RNA; a non-protein-coding transcript other than ribosomal RNA and transfer RNA. The specific type of ncRNA must be specified in the /ncRNA_class qualifier. *N_region #Extra nucleotides inserted between rearranged immunoglobulin segments. *operon #Region containing polycistronic transcript under the control of the same regulatory sequences. *oriT Origin of transfer; region of DNA where transfer is initiated during the process of conjugation or mobilization. *polyA_site #Site on an RNA transcript to which will be added adenine residues by post-transcriptional polyadenylation. *precursor_RNA #Any RNA species that is not yet the mature RNA product; may include 5' clipped region (5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3' UTR), and 3' clipped region (3' clip). *prim_transcript #Primary (initial, unprocessed) transcript; includes 5' clipped region (5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3' UTR), and 3' clipped region (3' clip). *primer_bind #Non-covalent primer binding site for initiation of replication, transcription, or reverse transcription. Includes site(s) for synthetic e.g., PCR primer elements. *propeptide #Coding sequence for the domain of a proprotein that is cleaved to form the mature protein product. *protein_bind #Non-covalent protein binding site on nucleic acid. *regulatory #Region of sequence that functions in the regulation of transcription or translation. The specific type of regulatory region must be specified in the /regulatory_class qualifier. *repeat_region #Region of genome containing repeating units. Some qualifiers such as rpt_type and satellite have controlled vocabularies. These qualifiers have check boxes or pull-down menus to ensure that the correct format is used. *rep_origin #Origin of replication; starting site for duplication of nucleic acid to give two identical copies. *rRNA #Mature ribosomal RNA ; the RNA component of the ribonucleoprotein particle (ribosome) that assembles amino acids into proteins. *S_region #Switch region of immunoglobulin heavy chains. Involved in the rearrangement of heavy chain DNA leading to the expression of a different immunoglobulin class from the same B-cell. *sig_peptide #Signal peptide coding sequence; coding sequence for an N-terminal domain of a secreted protein; this domain is involved in attaching nascent polypeptide to the membrane; leader sequence. *source #Identifies the biological source of the specified span of the sequence. This key is mandatory. Every entry will have, as a minimum, a single source key spanning the entire sequence. More than one source key per sequence is permittable. *stem_loop #Hairpin; a double-helical region formed by base-pairing between adjacent (inverted) complementary sequences in a single strand of RNA or DNA. *STS #Sequence Tagged Site. Short, single-copy DNA sequence that characterizes a mapping landmark on the genome and can be detected by PCR. A region of the genome can be mapped by determining the order of a series of STSs. *telomere #Experimentally characterized specialized DNA segment found at the ends of eukaryotic chromosomes. *tmRNA #Transfer messenger RNA; acts as a tRNA first, then an mRNA that encodes a peptide tag. *transit_peptide #Transit peptide coding sequence; coding sequence for an N-terminal domain of a nuclear-encoded organellar protein; this domain is involved in post- translational import of the protein into the organelle. *tRNA #Mature transfer RNA, a small RNA molecule (75-85 bases long) that mediates the translation of a nucleic acid sequence into an amino acid sequence. *unsure #A small region of sequenced bases, generally 10 or fewer in its length, which could not be confidently identified. *V_region #Variable region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for the variable amino terminal portion. Can be made up from V_segments, D_segments, N_regions, and J_segments. *V_segment #Variable segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for most of the variable region (V_region) and the last few amino acids of the leader peptide. *variation #A related strain contains stable mutations from the same gene (e.g., RFLPs, polymorphisms, etc.) that differ from the presented sequence at this location (and possibly others). *3'UTR #Region near or at the 3' end of a mature transcript (usually following the stop codon) that is not translated into a protein; trailer. *5'UTR #Region near or at the 5' end of a mature transcript (usually preceding the initiation codon) that is not translated into a protein; leader. >Biological Source Descriptor or Feature #This annotation is very important, as an entry cannot be processed by the databases unless it includes some basic information about the organism from which the sequence was derived. This basic information was entered previously in the submission, in the Organism and Sequences Form. The more detailed Organism Information form allows you to alter or add to the data you entered earlier. *Overview: Descriptor or Feature? #Sequin allows two types of biological source information to be entered, Biological Source Descriptors and Biological Source Features. Biological Source Descriptors, like other descriptors, provide organism information about an entire sequence, or an entire set of sequences, in an entry. Biological Source Features, like other features, provide organism information about a specific interval on a given sequence. #In most cases, you will want to use a Biological Source Descriptor, because all the sequences in the entry will derive from the same source. However, if you have sequenced a transgenic molecule, for example, one that is part plant and part bacterial, you would use Biological Source Features to annotate which sequence was derived from plant and which from bacteria. #To add a Biological Source Descriptor, select Biological Source under the Descriptor section of the Annotate menu. To add a Biological Source Feature, select Biological Source under the Bibliographic and Comments section of the Annotate menu. #Annotating a Biological Source Descriptor or Feature is similar to annotating any descriptor or feature. For help in creating descriptors and features, see the appropriate section of the help documentation. The following are instructions for filling out Biological Source-specific forms. *Organism Page **Names Subpage #The scrollable list contains the scientific names of many organisms. To reach a name on the list, either type the first few letters of the scientific name, or use the thumb bar. Click on a name from the list to fill out the scientific name field. If there is a common name for the organism, that field will be filled out automatically. You may also directly type in the scientific name. If you have any questions about the scientific or common name of an organism, see the NCBI taxonomy browser http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/ **Location Subpage ***Location of Sequence #From the selection list, please enter the location of the genome that contains your sequence. Most entries will have a "Genomic" location. A brief description of the choices in this pop-up menu were listed previously. ***Origin of Sequence #This menu is for the use of database personnel. Please leave this field empty. The Biological focus box should be checked in rare cases where multiple source features are annotated. **Genetic Codes Subpage #Please use these fields to select the nuclear and mitochondrial genetic code that should be used to translate the nucleic acid sequence. The genetic code for a eukaryotic organism is "Standard". If you selected an organism name from the scrollable list described above, this field was filled out automatically. Do not change these fields if they have been filled out automatically. #For more information regarding the translation tables available, see the NCBI Taxonomy page . **Lineage Subpage #This information is normally entered by the database staff. They will use the Taxonomy database http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/ maintained by the NCBI/GenBank. #If you disagree with the lineage supplied please notify the database staff. #If you are running Sequin in its network-aware mode, you will see a button labeled "Lookup Taxonomy". Click on this button to perform an automatic look-up of the taxonomic lineage of the organism. Sequin will perform the look-up by accessing the Taxonomy database and will fill out the Taxonomic Lineage and Division fields. #If you have any comments about the taxonomic lineage determined by Sequin, please submit these comments with your entry. Under the Sequin File menu, select Edit Submitter Info. Enter your comments in the box entitled "Special Instructions to Database Staff", on the Submission page. *Modifiers Page #This page allows you to enter additional information about the source and/or organism. Entering information is optional. **Source Subpage #Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional source information as text in the field at the bottom of the page. You may add multiple modifiers to describe the source organism. #Clicking on the X button to the right of the text box will remove the text and clear the modifier from the pull-down in that line. #If the sequence was determined from a PCR product, check the PCR primers box at the bottom of the page. This will launch a separate editor where you can enter the direction, name and sequence of all PCR primers. The Set field allows you to group which primers were used in the same PCR reaction. All primers used in the same reaction should list the same number under Set. This dialog is for PCR primers only, not for sequencing or other primers. #The following is a description of the available modifiers: #-Altitude: Geographical altitude of the location from which the sample was collected. Value should reflect distance in meters above or below sea level. #-Cell-line: Cell line from which sequence derives. #-Cell-type: Type of cell from which sequence derives. #-Chromosome: Chromosome to which the gene maps. #-Clone: Name of clone from which sequence was obtained. #-Clone-lib: Name of library from which sequence was obtained. #-Collected-by: Name of person(s) or institute who collected sample. Do not use accented or non-ASCII characters. #-Collection-date: Date sample was collected. Must use format 23-Mar-2005, Mar-2005, or 2005. #-Country: The country of origin of DNA samples used for epidemiological or population studies. A list of approved country designations can be found on the ISDC web pages. Additional text may be added after a colon. For example, /country="USA: Bethesda, MD" #-Dev-stage: Developmental stage of organism. #-Endogenous-virus-name: Name of inactive virus that is integrated into the chromosome of its host cell and can therefore exhibit vertical transmission. #-Environmental-sample: Identifies sequence derived by direct molecular isolation from an unidentified organism. You cannot include extra text when using this modifier; the text box will change to TRUE upon selection of this modifier from the pull-down list #-Genotype: Genotype of the organism. #-Germline: If the sequence shown is DNA and a member of the immunoglobulin family, this qualifier is used to denote that the sequence is from unrearranged DNA. You cannot include extra text when using this modifier; the text box will change to TRUE upon selection of this modifier from the pull-down list. #-Haplogroup: Combination of stable polymorphic variants clustered together in a specific combination which can indicate a common ancestor. #-Haplotype: Haplotype of the organism. #-Identified-by: Name of expert who identified specimen taxonomically. Do not use accented or non-ASCII characters. #-Isolation-source: Describes the local geographical source of the organism from which the sequence was derived #-Lab-host: Laboratory host used to propagate the organism from which the sequence was derived. #-Lat-Lon: Latitude and longitude of location where sample was collected. Mandatory format is decimal degrees N/S E/W. Selecting this modifier in the pull-down list will generate separate boxes for entering the information in the mandatory format. #-Linkage-group: Group of genes whose loci are physically connected and tend to segregate together during meiosis. #-Map: Map location of the gene. #-Mating-type: Designation of individual single-celled organisms and protists based on mating behavior. #-Metagenomic: Identifies sequence from a culture-independent genomic analysis of an environmental sample submitted as part of a whole genome shotgun project. You may not include extra text when using this modifier, instead the text box will change to TRUE upon selection. #-Plasmid-name: Name of plasmid from which the sequence was obtained. #-Pop-variant: Name of the population variant from which the sequence was obtained. #-Rearranged: If the sequence shown is DNA and a member of the immunoglobulin family, this qualifier is used to denote that the sequence is from rearranged DNA. You cannot include extra text when using this modifier; the text box will change to TRUE upon selection of this modifier from the pull-down list. #-Segment: Name of viral genome fragmented into two or more nucleic acid molecules. #-Sex: Sex of the organism from which the sequence derives. #-Subclone: Name of subclone from which sequence was obtained. #-Tissue-lib: Tissue library from which the sequence was obtained. #-Tissue-type: Type of tissue from which sequence derives. #-Transgenic: Identifies organism was the recipient of transgenic DNA. You cannot include extra text when using this modifier; the text box will change to TRUE upon selection of this modifier from the pull-down list. **Organism Subpage #Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional organism information as text in the field at the bottom of the page. You may add multiple modifiers to describe the source organism. #Clicking on the X button to the right of the text box will remove the text and clear the modifier from the pull-down in that line. #The following is a description of the available modifiers: #-Acronym: Standard synonym (usually of a virus) based on the initials of the formal name. An example is HIV-1. #-Anamorph: The scientific name applied to the asexual phase of a fungus. #-Authority: The author or authors of the organism name from which sequence was obtained. #-Bio-material: An identifier of the stored biological material from which the sequence was obtained. This qualifier should be used to cite collections that are not appropriate in specimen-voucher or culture-collection. Examples include stock centers and seed banks. Mandatory format is "institution code:collection code:material_id". However, only material_id is required. Selecting this modifier in the pull-down list will generate separate boxes for entering the information in the correct format. #-Biotype: See biovar. #-Biovar: Variety of a species (usually a fungus, bacteria, or virus) characterized by some specific biological property (often geographical, ecological, or physiological). Same as biotype. #-Breed: The named breed from which sequence was obtained (usually applied to domesticated mammals). #-Chemovar: Variety of a species (usually a fungus, bacteria, or virus) characterized by its biochemical properties. #-Common: Common name of the organism from which sequence was obtained. #-Cultivar: Cultivated variety of plant from which sequence was obtained. #-Culture-collection: Identifier and institution code of the microbial or viral culture or stored cell-line from which the sequence was obtained. This qualifier should be used to cite the collection where the author has deposited the culture or from which the culture was obtained. Personal library collections should be annotated in strain and not in culture-collection. Mandatory format is "institution code:collection code:culture_id". However, collection code is not required. Selecting this modifier in the pull-down list will generate separate boxes for entering the information in the correct format. #-Ecotype: The named ecotype (population adapted to a local habitat) from which sequence was obtained (customarily applied to populations of Arabidopsis thaliana). #-Forma: The forma (lowest taxonomic unit governed by the nomenclatural codes) of organism from which sequence was obtained. This term is usually applied to plants and fungi. #-Forma-specialis: The physiologically distinct form from which sequence was obtained (usually restricted to certain parasitic fungi). #-Group: Do not select this item. #-Host: Natural (as opposed to laboratory) host to the organism from which sequenced molecule was obtained. Use of the Latin name of the host organism is preferred. #-Isolate: Identification or description of the specific individual from which this sequence was obtained. An example is Patient X14. #-Metagenome-source: Used only for genome projects. Do not select this item. #-Pathovar: Variety of a species (usually a fungus, bacteria or virus) characterized by the biological target of the pathogen. Examples include Pseudomonas syringae pathovar tomato and Pseudomonas syringae pathovar tabaci. #-Serogroup: See serotype. #-Serotype: Variety of a species (usually a fungus, bacteria, or virus) characterized by its antigenic properties. Same as serogroup and serovar. #-Serovar: See serotype. #-Specimen-voucher: Identifier of the physical specimen from which the sequence was obtained. The qualifier is intended for use where the sample is still available in a curated museum, herbarium, frozen tissue collection, or personal collection. Mandatory format is "institution code:collection code:specimen_id". However, only specimen_id is required. Selecting this modifier in the pull-down list will generate separate boxes for entering the information in the correct format. #-Strain: Strain of organism from which sequence was obtained. #-Subgroup: Do not select this item. #-Sub-species: Subspecies of organism from which sequence was obtained. #-Substrain: Sub-strain of organism from which sequence was obtained. #-Subtype: Subtype of organism from which sequence was obtained. #-Synonym: The synonym (alternate scientific name) of the organism name from which sequence was obtained. #-Teleomorph: The scientific name applied to the sexual phase of a fungus. #-Type: Type of organism from which sequence was obtained. #-Variety: Variety of organism from which sequence was obtained. **GenBank Subpage #Please do not use this form. This field is reserved for information from NCBI's taxonomy database. *Miscellaneous Page **Synonyms Subpage #If there are alternative names for the organism from which the sequence was derived, enter them here. Please be aware that this is the appropriate field only for alternative names for the organism, not for alternative gene or protein names. **Cross-Refs Subpage #This page is for use by database staff only. >Publications *Publication Overview: Descriptor or Feature? #Sequin allows two types of publications to be entered, Publication Descriptors and Publication Features. Publication Descriptors are bibliographic references that, like other descriptors, cover an entire sequence, or an entire set of sequences, in an entry. Publication Features are bibliographic references that, like other features, cover a specific interval on a given sequence. #Publications are entered into the Reference field of the database entry. References are citations of unpublished, in press, or published works that are relevant to the submitted sequence. Publications should provide information regarding the principle cloning and determination of the sequence within the record. #In general, there is one publication describing a sequence, and a Publication Descriptor should be used. To enter a Publication Descriptor, select Publications under the Annotate menu and click on Publication Descriptor. #However, if one publication describes the cloning of the 5' end of a gene, and another publication describes the cloning of the 3' end of the gene, Publication features may be used. To make a publication feature, choose Publication Feature in the Publications section of the Annotate menu. Enter the information about the publication, and then enter the nucleotide interval to which the publication refers on the Location page. *Citation on Entry Form **Status #Using the radio buttons, select one of the three options: #-Unpublished: Select this option if a manuscript has been written but not yet submitted or has been submitted for publication but has not yet been accepted. #-In Press: The article has been accepted for publication but is not yet in print. If the article appears online prior to print publication, use this option. #-Published: The article has been published. **Class #Using the radio buttons, select the type of publication in which the sequence will appear. #-Journal #-Book Chapter #-Book #-Thesis/Monograph #-Proceedings Chapter: Abstract from a meeting #-Proceedings: A meeting #-Patent #-Submission **Scope #Using the radio buttons, select one of the options. #-Refers to the entire sequence: Most publications should be classified as such. #-Refers to part of the sequence: For use only when a publication discusses only part of the presented sequence. You must enter the locations in the location tab in later forms. This selection is only valid when adding a Publication feature, not descriptor. #-Cites a feature on the sequence: This selection should only be made in limited cases. Its use must coincide with the use of the /citation qualifier on the given feature. #After you have filled out the Citation on Entry form, click on "Proceed" to see the next form. *Citation Information Form (General) **Authors Page ***Names Subpage #Please enter the names of the authors. Note that the first name of the author is listed first. You can add as many authors to this page as necessary. After you type in the name of the third author, the box becomes a spreadsheet, and you can scroll down to the next line by using the thumb bar. The suffix toggle allows the addition of common suffixes to the author name. The consortium field should be used when a consortium is responsible for the sequencing or publication of the data. The consortium should not be the department or institute affiliation of the authors. Individual authors may be listed along with a consortium name. ***Affiliation Subpage #Please enter information about the institution where the sequencing was performed. #Other pages in the Citation Information Form will be different, depending on the Class of publication selected in the Citation on Entry Form. Instructions for filling out the Citation Information Form for Journals is included here. *Citation Information Form (If Selected Class Was Journal) **Title Page #Enter title for manuscript in the box. **Journal Page #Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year fields by typing information into the boxes. Select the month with the pop-up menu. If necessary, choose an option from the Erratum pop-up menu and explain the erratum. #If you are running Sequin in its network-aware mode, the program will look up the Title, Author, and Journal information in the MEDLINE database if you supply it with some minimal information. For example, if you know the MUID (MEDLINE Unique Identifier) of the publication, enter it in the appropriate box and select "Lookup By MUID." Sequin will automatically retrieve the rest of the information. One way to find the MUID of the publication is to look up the publication with the NCBI's Entrez service. Alternatively, if you do not know the MUID, enter the Journal, Volume, Pages, and Year. Then select "Lookup Article". Sequin will retrieve the missing Title and Author information. #The PubStatus toggle is used by database staff. If you have used the "Lookup by MUID" or "Lookup by PMID" functions, this field may be populated. Please do not edit the information. **Remark Page #This page is reserved for use by the database staff. >File Menu *About Sequin #Details about the current version of Sequin. *Help #Launches the help documentation. *Open #Open an existing entry. This option will open a record that has been previously saved in Sequin. Furthermore, for analysis purposes, it can also open a FASTA-formatted sequence file. The sequence will be displayed in Sequin and can be analyzed, but it should not be submitted, because it does not have the appropriate annotations. *Close #Close this entry. *Export GenBank #Exports the currently displayed format to a file. Do not use export ASN1 for submission of sequences to the database. *Duplicate View #Duplicates the entry. You can then view the entry simultaneously in different Display Formats. *Save #Saves the entry. Note: This merely saves the entry so you can go back and edit it. It does not prepare the entry for submission to the database, that is, it does not validate the entry. *Save As #See Save. *Save as Binary Seq-entry #Saves the file in a compressed format and should be used only when the file is to be imported into other analysis programs. Do not use this option to save files for submission directly to GenBank. *Restore #Replaces the displayed record with a previously saved version. This feature is useful if you have made unwanted changes since you last saved the record. *Prepare Submission #Prepares the entry for submission to the database. See Submitting the Finished Record to the Database in the Sequin help documentation. *Print #Prints the window that is currently selected. The selected window can be one of the Sequin forms or pages, or the help documentation. *Quit #Exit from Sequin. >Edit Menu *Copy #Copy the selected item. *Clear #Clear the selected item. *Edit Sequence #To edit a single sequence, select the sequence identifier in the Target Sequence pop-up menu, and click on Edit sequence. The sequence editor will be launched for that sequence. The sequence editor is discussed in more detail below. *Alignment Assistant #This option will launch the Alignment Assistant which is discussed in more detail below . *Sequence Deletion Tool #This option will launch a dialog window where you can select sequences that should be deleted from your submission. All of the current sequences within the submission are listed in the left panel, Sequences in your file. Check the box next to the sequence you want to remove. The sequence will be listed in the right panel, Sequences selected for deletion. You can also paste the SeqID for a list of records to be deleted at the bottom of the form. After pasting the list, click on the Select sequences in this list button to populate the right panel. Since GenBank requires a minimum length of 200 base pairs, you can similarly remove all sequences with lengths less than 200. Carefully review your selections in the right panel before clicking Accept. If the sequence you are deleting is part of an alignment and is not already part of the GenBank database, a pop-up box will appear indicating that the sequence will be removed from the alignment as well as the submission. *Edit Submitter Info #Opens up the Submission Instructions form, which allows you to enter additional information about the person submitting the record. Much of this information was entered on the first form in Sequin, the Submitting Authors form. #You can also save the information from the Submitting Authors form here, so that you can use it in subsequent Sequin submissions. Click on "Edit Submitter Info" and, under the file menu in the resulting Submission Instructions form, click on Export Submitter Info to save the information to a file. For subsequent Sequin submissions, if you have already saved the submittor information, click on Import Submitter Info under the File menu on the Submission page of the Submitting Authors form. **Submission Page #Indicate the type of submission. Check either the "Yes" or "No" radio button to indicate if the record should be released before publication. If you select "Yes", the entry will be released to the public after the database staff has added it to the database. If you select "No", fields will appear in which you can indicate the date on which the sequences should be released to the public. The submission will then be held back until formal publication of the sequence or GenBank Accession number, or until the Release Date, whichever comes first. If you have any special instructions, enter them in the box at the bottom of the page. **Contact Page #Update the name, affiliation, or contact numbers of the person submitting the record. Please supply a fax number to facilitate communication with database staff. **Citation Page #Update the names and affiliation of the people who should receive scientific credit for the generation of sequences in this entry. The address should list the principal institution in which the sequencing and/or analysis was carried out. *Update Sequence #This selection allows you to replace a sequence with another sequence, merge two sequences that overlap at their ends, 'patch' a corrected fragment of a sequence to the current sequence, or copy features from one sequence to another. #Use Single Sequence to import a sequence in FASTA or ASN.1 format (for example, a sequence record that has already been saved in Sequin). If you are running Sequin in Network Aware mode, you can use Download Accession to import a record from Entrez. The Multiple Sequences option allows you to update multiple sequences using either FASTA or ASN.1 formats. In either format, each sequence identifier must be identical in the new and old sequences. #After you import the updated sequence, a new window will open that displays two graphical views and the text of the alignment of the new and old sequence. The first graphic displays the relative length of the two sequences and the length of the overlapping region between sequences. The second graphic represents any inserts, deletions, or point changes within the aligned region between the new and old sequences. Clicking on a region in this graphic will scroll to the corresponding nucleotide sequence in the alignment text below. #The Sequence Update box to the left shows the action that will be performed upon updating the sequence, i.e., no change, replace, extend 5', extend 3', or patch. The patch function allows you to replace an internal fragment of the sequence without affecting flanking regions. You can also override the alignment between the new and old sequence using the Ignore alignment checkbox to force a sequence change of replace, Extend 5' or Extend 3'. This option allows you to append new sequence to with no overlap. #If the current sequence has annotation, you can use the Existing Features box to determine whether the annotation should remain or be removed upon updating the sequence. The Do not remove option is the default. However, you may chose to remove annotated features only in the aligned area, outside the aligned area, or to remove all currently annotated features. #When updating via Download Accession or an ASN.1 file, the Import Features box allows you to specify whether features from the new file should be imported to the existing record. The dialog offers different options for cases where the features on the new file are identical to those on the existing record. #If you are using the Multiple Sequences option, you may choose to review the sequences and update them one by one using the Update this Sequence box at the bottom of the window. You may skip a sequence update or choose to update all sequences at once without reviewing them in the Update Sequence dialog. #In any case, please carefully review the sequence and annotation in the record viewer after using the Update Sequence function. *Feature Propagate #This selection allows you to propagate any annotated feature from one sequence in an aligned set to other sequences within the set. For example, if one nucleotide sequence in the alignment contains a CDS feature, you can annotate a similar CDS on the other nucleotide sequences in the set. #The default source of features to be propagated is the first member of the set. If you would like to use a different entry as the source of the features, scope to that entry in the Target Sequence menu before selecting Feature Propagate from the Edit menu. #The Feature Propagate window allows you to select which sequences should receive the new annotation and which features will be propagated. You can also select whether the features will be extended or split at gaps in the alignment. The split at gaps selection will produce two features, one on either side of the gap within the alignment. If you are propagating a CDS feature, you may specify that the translation end or extend through internal stop codons. You may also extend the translation after the stop codon on the source entry by chosing to translate the CDS after partial 3' boundary. If the CDS that you are propagating to other records is partial on either end, you should select the 'Cleanup CDS partials after propagation' check box. This will retain the partial nature of the CDS features on all records. The fuse adjacent propagated intervals function will create one feature from two of the same type that contain abutting nucleotide intervals due to the nature of the alignment used for propagation. *Add Sequence #This selection allows you to add a new sequence to an existing population, mutation, phylogenetic, or environmental sample set. You may import the new entry in FASTA format or ASN.1 format (for example, a sequence record that has been saved in Sequin). >Search Menu *Find ASN.1 #Under this command, you can find and replace strings of letters in those fields of your submission that contain manually entered data. The fields that can be altered are Locus, Definition, Accession, Keywords, Source, Reference, and Features. To use this option, select Find and fill the Find and Replace lines with the appropriate text. Note that you cannot edit the sequence in this way. *Find FlatFile #Under this command, you can find strings of letters in all fields of your submission. You can use the Find First and Find Next buttons to identify the specified text sequentially through the flatfile. *Find by Gene #This option allows you to move quickly in the record viewer to a gene feature containing the specified gene symbol. *Find by Protein #This option allows you to move quickly in the record viewer to a CDS feature containing the specified product name. *Find by Position #This option allows you to move quickly in the record viewer to any feature annotated at the specified nucleotide location. *Validate #This option detects discrepancies between the format of your submission and that required by the database selected for entry. If discrepancies are present, it suggests ways in which to correct them. See the topic on Submitting the Finished Record to the Database in the Sequin help documentation. *Vector Screen #The UniVec option allows you to run a BLAST search of your nucleotide sequence(s) against NCBI's UniVec database. We highly recommend that you run this analysis and remove any vector contamination before submission. The UniVec database contains only one copy of every unique sequence segment from a large number of vectors. It also contains sequences for adapters, linkers and primers commonly used. #To run Vector screen on a submission containing multiple sequences, scope to ALL SEQUENCES in the Target Sequence pull-down before running the analysis. If there are many sequences, a status bar will appear indicating the progress of the search. If no contamination is found, a pop-up box will appear to notify you. If contamination is found, a miscellaneous feature will be annotated on the flatfile with the location of the contamination. Details will include the relative strength of the BLAST hit. You must trim the nucleotide sequence to remove this feature before submission. #The Vector Search and Trim Tool is described in the submission dialogs. *ORF Finder #The ORF Finder shows a graphical representation of all open reading frames (ORFs) in the nucleotide sequence. This tool allows you to select ORFs and have them appear as coding sequence (CDS) features on the sequence record. #The ORFs, indicated by colored boxes, are defined as the longest sequence containing a start codon and stop codon. All six reading frames are shown as separate lines in the graphical view. The top three lines represent the plus strands, and the bottom three lines the minus strands. In the default view, the nucleotide sequence intervals of the ORFs are displayed in descending length order on the right side of the window. Intervals on the complementary (minus) strand are indicated by a 'c'. Selecting 'Order by Start' will reorder the list based on the nucleotide location of the start codon. #Clicking on the box labelled ORF changes the graphical display so that the potential start codons are indicated in white, and stop codons in red. #The default settings display only those ORFs which contain an ATG start codon. Selecting 'Alternative' in the 'Initiation Codon' box, will also include ORFs beginning with all valid alternative start codons as determined by the genetic code listed in the source feature. If the genetic code for the source organism has not been specified, the default standard genetic code will be used. #The ORF length button sets the length of ORFs that are displayed. For example, the default of 10 shows all ORFs that are greater than 10 nucleotides in length. #Checking the Show Partial ORFs box will display ORFs that extend to the end(s) of the nucleotide sequence but are 5' or 3' partial. #ORFs can be selected by clicking on the graphical representation or on the sequence interval. Once an ORF has been selected, its location and amino acid sequence will automatically be fielded in the CDS feature editor accessed under the Annotate menu. *Select Target #This option changes the sequence that is selected in the Target Sequence pop-up. Type the SeqID of the sequence in the box, and the record viewer will be updated to display that sequence. >Misc Menu *Net Configure #As a default, Sequin is available as a stand-alone program. However, the program can also be configured to exchange information with the NCBI (GenBank) over the Internet. The network-aware mode of Sequin is identical to the stand-alone mode, but it contains some additional useful options. #Sequin will only function in its network-aware mode if the computer on which it resides has a direct Internet connection. Electronic mail access to the Internet is insufficient. In general, if you can install and use a WWW browser on your system, you should be able to install and use network-aware Sequin. Check with your system administrator or Internet provider if you are uncertain as to whether you have direct Internet connectivity. #There are two ways to change Sequin into its network-aware mode. If you are still on the initial Welcome to Sequin form, select Net Configure under the Misc menu. If you have already worked on a Sequin submission and are looking at the record in the record viewer, select the Net Configure option from the Misc menu. #Most users will be able to use the default (Normal) settings on the Network Configuration page; select Accept to complete the configuration process. #If a "Normal" Connection does not work, you may need to select the Firewall Connection. Contact your system administrator to determine what to enter into the Proxy and Port fields. If you do not have access to the domain name server (DNS), uncheck this box. #The Timeout pop-up selects the length of time that your local copy of Sequin will wait for a reply from the NCBI server. You may need to set this number higher (i.e., 60 seconds or 5 minutes) if you are outside of the United States or have a bad internet connection. #If you have problems setting up the network configuration, contact info@ncbi.nlm.nih.gov. #If you would like to change Sequin back to its stand-alone mode, select Net Configure again from the Misc menu. Click on Connection: None. #The network-aware mode of Sequin allows you to perform a number of additional, important functions. These functions all appear as additional menu items. A brief description of these functions follows. Further descriptions are available as indicated elsewhere in the help documentation. **Performing a PubMed Look-Up #In its network-aware mode, Sequin can import the relevant sections of a PubMed record directly into a sequence submission record. Rather than typing in the entire citation, you can enter minimal information, such as the PubMed Unique Identifier (PMID), or Journal name, volume, year, and pages. The PubMed lookup is explained in the section of the documentation entitled Publications. **Performing a Taxonomy Look-up #In its network-aware mode, Sequin can look up the taxonomic lineage of an organism from the NCBI's Taxonomy database. This look-up is normally performed by the NCBI database staff after the record has been submitted to GenBank. If you look up the taxonomy before submitting the sequence, you can make a note in the record of any disagreements. The taxonomy lookup is explained in the section of the documentation covering Biological Source: Organism page: Lineage subpage. **Accessing the NCBI DeskTop #The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu. *NCBI DeskTop #This option is only available if you are running Sequin in its network-aware mode. #The NCBI DeskTop provides a view of the internal structure of the Sequin record, the ASN.1. Its display resembles a Venn diagram and represents all the structures represented in the ASN.1 data model. #In addition, a number of undocumented software tools from the NCBI can be accessed from the DeskTop. These tools are components of the NCBI portable software Toolkit. You can also customize these functions using the Toolkit with your own software tools. The Toolkit and its documentation are available from the NCBI by anonymous FTP. #The DeskTop should only be used by very seasoned users. At this time, we are not providing any documentation for these specialized functions. >Annotate Menu #This menu allows you to enter features and descriptors on the sequence. #The first six options, Genes and Named Regions, Coding Regions and Transcripts, Structural RNAs, Bibliographic and Comments, Sites and Bonds, and Remaining Features refer to types of Features that can be added to the sequence. Features are described in more detail in the above section entitled Features. #If you are submitting a set of similar sequences, you can add the same feature across the entire span of each by using the Batch Feature Apply option. The feature must span the entire nucleotide sequence of each member; you can not annotate specific nucleotide locations using this option (for this, see Feature Propagate). For each feature, you will be prompted to designate whether the feature is 5' or 3' partial and whether is is on the plus or minus strand. You may also add a comment or other qualifier to the feature. The Add Qualifier option allows you to add a qualifier to an existing feature. You must specify the feature and qualifier in the Add Qualifier pop-up box. Source qualifiers can be added to all entries using the Add Source Qualifier option. Qualifiers specific to the CDS and gene can be added using Add CDS-Gene-Prot-mRNA and RNA qualifiers using Add RNA Qual. In each case, a pop-up box appears with qualifier options appropriate for that feature. #The Batch Feature Edit function allows you to edit existing qualifiers. For each menu choice, a pop-up box allows you to select the feature containing the qualifier and the specific qualifier to be edited. You can use the Find/Replace text boxes to edit the information contained within the qualifier. #Batch Apply Molecule Type allows you to apply the same molecule type to all nucleotide sequences within your submission. The choices in this dialog are explained in the Specify Molecule section of this document. #Batch Apply Genetic Code allows you to apply the same genetic code to be used for all sequences in the submission. For more information regarding the genetic codes available, see the NCBI Taxonomy page. #The Set Release Date dialog allows you to change the release date specified in the Submission Dialogs. #The ORF Finder function is available in both the Annotate and Search menus. #Import Source Table allows you to add unique information for one source qualifier for each of the records in a batch or set. The input file must be in the format of a tab-delimited, two column table. The first column should list the SeqID exactly as it was listed in the original FASTA file. The second column should list the text value for the desired source qualifier for each record. Once the file has been imported, a pop-up box will appear with the source qualifiers listed in the pull down menus. The qualifiers are separated into three menus: one for taxonomic information, one for the Organism modifiers and one for the Source modifiers. #The Publications option allows you to add a Publication Feature or Publication Descriptor to the record. Publications are described in more detail in the above section entitled Publications. #The Descriptors option allows you to add Descriptors to the record. Descriptors are described in more detail in the section entitled Descriptors, above. #The Advanced Table Readers option imports a properly formatted structured comment table. Please contact us if you wish to use this option. #Sort Unique Count by Group opens a new window which displays your record(s) the number of times an individual line appears in the flatfile(s). This is particularly useful when checking that all records in a large set contain the required source or feature information. >Options Menu #This menu is only available when using Sequin in its network-aware mode. *Font #Use this item to change the display font. From the pop-up menus, choose the style and size of type. For additional changes, mark the Bold, Italic, or Underline check boxes. The default font is 10-point Courier. >Sequence Editor #This editor allows you to modify the nucleotide or amino acid sequences and corresponding annotation in your entry. Although the Sequence Editor does allow you to undo changes you make to the sequence, we strongly suggest that you save a copy of the entry before launching the Sequence Editor so that you can revert to it if necessary. *Starting the Sequence Editor #The sequence that appears in the editor is dependent on the sequence(s) selected in the Target Sequence pull-down list. There are two ways to launch the sequence editor for nucleotide sequences. First, you can double click within sequence in any display format of the record viewer. A window containing the DNA sequence will appear. Second, in the record viewer, select the sequence that you would like to edit in the Target Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You can launch the editor for protein sequences by selecting the protein sequence in the Target Sequence pop-up menu and double clicking within the protein sequence. A window containing the protein sequence will appear. *Moving around the Sequence Editor #The cursor can be moved with the mouse or the arrow keys. The display window will change to show the position of the cursor. The sequence location of the first residue on each line is indicated on the left side of the window. The cursor location, or the range of sequences selected by the mouse, is shown in the upper left corner of the window. If you want to move the cursor to a specific location, type the number in the box on the top left of the sequence editor window, and hit the Go to button. If you want to look at a specific sequence, but not move the cursor to it, type the number in the upper right box of the window and hit the Look at button. *Editing Sequence and Existing Annotation #Select a piece of sequence by highlighting it with the mouse. To select the entire sequence, click on a sequence location number on the left side of the window. Any sequence that is highlighted in the Sequence Editor will show up as a box on the sequence when it is viewed in the Graphic Display Format. #One way to insert and delete residues is with the mouse. Move the cursor to the appropriate location and type. Text will be inserted to the left of the cursor. Delete sequence with the backspace or delete key. Text will be deleted to the left of the cursor. To delete a block of sequence, highlight it with the mouse and use the delete or backspace key. #Another way to insert and delete residues is with options under the Edit menu of the Sequence Editor. Use Cut to remove, or Copy to copy, highlighted residues. Copied residues can then be pasted elsewhere within the sequence by using the Paste option. #Features annotated via the record viewer will be displayed in a graphical format within the sequence editor. CDS features will be be displayed as a blue line across the appropriate nucleotide location. All other features will be displayed as a black line. To the left of the line, the name of the feature is displayed. In the case of CDS or mRNA features, the product name is shown. For gene features, the gene locus is shown. #Double-clicking on the feature will launch the feature editor just as in the record viewer. However, you can also change the nucleotide location of any feature within the graphical view. To move the entire feature, select the feature and drag it to the appropriate location while holding down the mouse button. To alter the 5' or 3' end of a feature, click on the feature's end and drag to the new location while holding down the mouse button. #Before moving the nucleotide locations of a CDS feature, it may be useful to view the codons in the current translation. You can do this by clicking on the feature line and releasing the mouse button. A grid will be displayed that shows the triplet location for the current annotation. Once you have changed the nucleotide location of a CDS feature in the graphical view, you can see the new translation by using the Translate CDS button at the bottom of the window. #To save changes you have made to the sequence, press the Accept button at the bottom of the Sequence Editor display window. If you do not want to save the changes, press the Cancel button at the bottom of the Sequence Editor display window. Selecting either Accept or Cancel will quit the Sequence Editor and return you to the record viewer. Any changes you make will not become a permanent part of the Sequin record until you Save the record in the record viewer. #New features can be added using the Features menu. *Sequence Editor Window Buttons **Go to #Moves the cursor to the indicated location. **Look at #Moves the window to the indicated location without moving the cursor. **Merge Feature Mode/Split Feature Mode #In merge mode, any new sequence that is entered into a region spanned by an existing feature becomes part of that feature. For example, if you enter new sequence in the middle of a CDS, that sequence will be translated as part of the CDS. In split mode, the new sequence interrupts the feature. For example, if you enter new sequence in the middle of a CDS, the CDS will be interrupted by that sequence (see the location of the CDS in the record viewer). **Numbering #Allows the sequence location numbering to be hidden, displayed on the side, or displayed on the top of the sequence. **Grid #Allows the display to show a grid separating each feature and sequence for easier viewing. **Show/Hide Features #This box toggles between hiding and showing the features on a sequence. **Accept #Closes the Sequence Editor after saving all of the changes made to sequences and features. **Cancel #Closes the Sequence Editor without saving any changes made to sequences or features. **Translate CDS #Allows translation of coding region features after the location has been changed within the graphical view. *Sequence Editor File Menu **Export #Allows the export of a range of sequence as a FASTA file or text file. Using the text option will also export overlapping features if they are displayed. If the features are first hidden, only the sequence will be exported. All protein translations displayed at the time of export, will be exported as well. **Accept #Closes the Sequence Editor after saving all of the changes made to sequence and features. **Cancel #Closes the Sequence Editor without saving any changes made to sequences of features. *Sequence Editor Edit Menu **Undo #Undoes all actions performed in the Sequence Editor since the last save. **Redo #Restores changes removed with Undo option **Cut #Removes the highlighted sequence. This sequence can be pasted elsewhere. **Paste #Pastes a cut or copied sequence to the right of the cursor. **Copy #Copies the highlighted sequence. This sequence can be pasted elsewhere. **Find #Allows you to find DNA or amino acid sequence patterns in your sequence. The search is case insensitive. To find an exact match to a DNA sequence pattern, type the pattern in the box. The number of items found will be displayed and you can toggle through each instance with the Find Next button. To find the reverse complement of the pattern, click on the reverse complement box at the bottom of the pop-up box. #To find an exact match to an amino acid sequence pattern, type that sequence in the box, and click on "translate sequence". Sequin will look for all occurrences of that pattern in all six open reading frames. The DNA sequence encoding that protein sequence in any of the six reading frames will be hightlighted. **Translate CDS #Allows translation of coding region features after the location has been changed within the graphical view. **Complement #Shows the complement of the submitted strand underneath the original. **Reading Frames #Shows the indicated phase translation of the selected coding sequence. You can select any or all of the six reading frames, all reading frames or all positive or negative frames. **Protein Mismatches #Indicates amino acid which does not match conceptual translation following a nucleotide sequence change. The original amino acid sequence will be displayed until the Translate CDS function is used. Differences will be indicated by a red box around the amino acid abbreviation. **On-the-fly Protein Translations #Creates a second amino acid sequence in the display which retranslates as the nucleotide sequence is changed to allow side-by-side comparison to the original amino acid sequence. *Sequence Editor Features Menu #The menu contains a long list of all features that can be annotated on a sequence. These features are the same as those that are accessible through the main Sequin Annotate menu. #You can annotate features either in the Annotate menu or in the Sequence Editor. If you annotate them in the Annotate menu, you must type in the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you can highlight the sequence that the feature covers, and the location of the sequence will be automatically entered in the feature location box. Additional explanations of how to annotate features are provided in the section on Features. >Working with Sets of Aligned Sequences #Sequin allows you to work with aligned sets of closely related nucleotide sequences that are part of a population, phylogenetic, or mutation study. If the sequences are imported in a pre-aligned format, such as PHYLIP, Sequin uses this alignment. If the sequences are imported individually in FASTA format, Sequin can generate its own alignment. #You can view the aligned sequences in the Sequence Alignment Editor. In the record viewer, select All Sequences in the Target Sequences menu, and select the Alignment Display Format. #The Alignment Assistant is launched by selecting Alignment Assistant from the Edit menu in the record viewer. It can be used to apply features to the whole set of sequences using the alignment coordinates. Rather than calculating the nucleotide coordinates for every feature on every nucleotide sequence, you may select the feature's location using its alignment coordinates and apply it to every member of the set simultaneously. Sequin will calculate the nucleotide locations as they apply to each member of the set. *Alignment Assistant Window Buttons **Go to #The Go to alignment position and Go to sequence position buttons both scroll the aligment assistant so that the requested position is visible. If the requested position is already visible, nothing will happen. Unlike the Sequence editor window, the 'go to' button does not control the cursor position. **Numbering #Allows the sequence location numbering to be hidden, displayed on the side, or displayed on the top of the sequence. **Grid #Allows the display to show a grid separating each feature and sequence for easier viewing. **Features Toggle #It is possible to view annotated features in the aligment assistant. The features are displayed as a bar underneath the coordinates for that feature. The identity of the feature is displayed in the left-hand column. The default selection is to have the features Hidden. You may display the features associated only with the Target Sequence or features annotated on All Sequences in the alignment. *Alignment Assistant File Menu **Export #Allows you to export the alignment to a file in three different formats. The contiguous and interleaved options export the alignment accordingly in FASTA+GAP format. The text representation option saves the alignment as it appears in the Alignment Assistant. Note that with this option features are included if they are displayed at the time of export. **Close #Closes the Alignment Assistant window and saves any changes made. *Alignment Assistant Edit Menu **Remove Sequences from Alignment #Allows you to remove selected sequence(s) from the alignment. Select the sequence by clicking on it. You can select multiple sequences by holding down the control key. The sequence will then be highlighted in grey. Note that this option will remove the sequence from the alignment, but it is still present in your submission. **Validate Alignment #Checks for problems with the alignment. If errors are reported, please review and attempt to fix your alignment before submission. **Propagate Features #This function is the same as that available under the Edit Menu in the record viewer. A full description is available above . *Alignment Assistant View Menu **Target #Allows you to select a sequence within the alignment as the target sequence. This can also be done by double-clicking on the sequence within the alignment. The SeqID of the target sequence will be displayed in red. Features can be displayed on the target sequence only and it is the sequence used for comparison in the Show Substitutions view. **Show Substitutions #Changes the alignment view so that identities are replaced with a "." and only substitutions are shown. The substitutions and identities are relative to the selected target sequence. *Alignment Assistant Features Menu #Allows the annotation of features to a single sequence or all sequences within the alignment. All features available in this menu are discussed through the main Sequin Annotate menu. #Select the feature location by clicking the start location on one of the sequences, keeping the mouse button depressed, drag the cursor to the end of the feature location. The selected area will now be underlined and red and the alignment coordinates of this area will be displayed in the upper left of the Alignment Assistant window. **Apply to Target Sequence #Allows you to choose a feature to be applied only to the target sequence. The locations may be entered manually or can be determined based on highlighting the sequence as described above. **Apply to Alignment #Allows you to add the selected feature to all sequences within your alignment based on the alignment coordinates you have selected. Note that in the feature pop-up boxes in this menu, the Location will always be entered as the location relative to the alignment coordinates.
 
Questions or Comments?
Write to the NCBI Service Desk
Revised December 5, 2016