BIRCH

return to tutorials

TUTORIAL: FINDING AND RETRIEVING COMPLETE EUKARYOTIC GENOMES


Nov. 19, 2025

ENTREZ documentation: http://www.ncbi.nlm.nih.gov/books/NBK44864/


Rationale: There are numerous reasons why it is important to be able to retrieve complete genomes. These include genome assembly and genome annotation, transcriptome projects, and analysis of genome structure and evolution.

In many cases, there may be a number of alternative assemblies of a genome, as well as contig and scaffold files with parts of chromosomes. In other cases, genome assemblies may consist of hundreds or thousands of contigs, and in many cases we don't know which chromosomes each contig falls on. In principle, prokaryotic genomes should be easy to find and download, since prokaryotic genomes are typically single, circular DNA molecules. The reality is that even for prokaryotic genomes, the vast majority are not single sequences, but rather a collection of contigs.

The most comprehensive source for genomic sequences is the Genome repository at the NCBI. To illustrate the process of finding and downloading genomes, a good test subject is the species in the genus Saccharomyces. These fungi are referred to as yeasts, and qualify as eukaryotes, but still have small genomes that make them easy to work with.

Overview:
Goal: To find and download genomes from two Saccharomyces species, and save them in formats that facilitate further genome analysis.

1. Find genome files at the NCBI Genomes site

I can't repeat this often enough. ALWAYS create a new directory for each project.
mkdir getgenome
cd getgenome

For genome downloads, the user may choose one or more files with sequence and annotation in various formats. For this reason, files are distributed in zip archives which include subdirectories and metadata files. Since this tutorial only requires the FASTA sequence file, create a temporary directory for the download that will make it simpler to delete the remaining files later.

mkdir temp
cd temp



The best starting point is the Genome page at NCBI [https://www.ncbi.nlm.nih.gov/genome].

Enter "Saccharomyces cerevisiae" into the Search box.

DISCLAIMER: NCBI changes the organization of their genome pages relentlessly. Pages shown in this and subsequent tutorials may be different. You may need to do a bit of navigating to find a particular genome release.



Note that for some species, there are many assemblies from  different sequencing projects, and often from different strains. As we'll see next, NCBI has designated for each genome a reference assembly.
Choose the reference assembly, R64.






This page has links for downloading sequences and annotation in a variety of formats
  • sequence files - files in Fasta or GenBank formats for genomic DNA, mRNA transcripts, and proteins
  • annotation - files in GFF, GenBank or tab-separated value formats containing the locations and names of features, such as coding sequences, exons, introns, repetitive elements etc.
Choose GenBank only and Genome sequences (FASTA)
Scroll down and click on the Download button


NOTE!!! Before downloading, make sure that your web browser is set to prompt you for a location to save your files. To keep things simple, it is best to avoid the Downloads directory, and save the file directly in the getgenome/temp directory. The next steps assume that the zip file is saved in temp.


If you need annotation... It should be emphasized that FASTA files do not contain any annotation information. For cases in which you want to utilize this information, for example, in browsing a genome, you would need to download either the GFF file or the GenBank file. GenBank files contain both annotation and sequence for each chromosome.

 There should now be a zip file:

-rw-r-----. 1 birch birch 3826228 Nov 19 17:52 ncbi_dataset.zip

This file is an archive containing some metadata (information on the files) as well as the FASTA sequence file itself. To de-archive the file:

unzip GCA_000146045.2.zip
Archive:  ncbi_dataset.zip
  inflating: README.md              
  inflating: ncbi_dataset/data/data_summary.tsv 
  inflating: ncbi_dataset/data/assembly_data_report.jsonl 
  inflating: ncbi_dataset/data/GCA_000146045.2/GCA_000146045.2_R64_genomic.fna 
  inflating: ncbi_dataset/data/dataset_catalog.json 
  inflating: md5sum.txt

The directory will now look like this:

-rw-------. 1 birch birch     321 Nov 19  2025 md5sum.txt
drwxrwxr-x. 3 birch birch    4096 Nov 19 17:56 ncbi_dataset
-rw-r-----. 1 birch birch 3826228 Nov 19 17:52 ncbi_dataset.zip
-rw-------. 1 birch birch    1593 Nov 19  2025 README.md

To find the sequence file we need to go down several levels of directories. For example,

{mercury:/home/birch/test/PLNT3140/getgenome/temp}cd ncbi_dataset
{mercury:/home/birch/test/PLNT3140/getgenome/temp/ncbi_dataset}ls -l
total 4
drwxrwxr-x. 3 birch birch 4096 Nov 10 09:03 data
{mercury:/home/birch/test/PLNT3140/getgenome/temp/ncbi_dataset}cd data
{mercury:/home/birch/test/PLNT3140/getgenome/temp/ncbi_dataset/data}ls -l
total 16
-rw-------. 1 birch birch 1523 Nov 19  2025 assembly_data_report.jsonl
-rw-------. 1 birch birch  542 Nov 19  2025 dataset_catalog.json
-rw-------. 1 birch birch  353 Nov 19  2025 data_summary.tsv
drwxrwxr-x. 2 birch birch 4096 Nov 19 17:56 GCA_000146045.2
{mercury:/home/birch/test/PLNT3140/getgenome/temp/ncbi_dataset/data}cd GCA_000146045.2
{mercury:/home/birch/test/PLNT3140/getgenome/temp/ncbi_dataset/data/GCA_000146045.2}ls -l
total 11992
-rw-------. 1 birch birch 12223592 Nov 19  2025 GCA_000146045.2_R64_genomic.fna


This is the file we want. Move it up 4 levels to the getgenome directory. (Remember that two dots (..) stand for the parent directory.)

mv GCA_000146045.2_R64_genomic.fna  ../../../..
cd ../../../..
ls -l

-rw-------. 1 birch birch 12223592 Nov 19  2025 GCA_000146045.2_R64_genomic.fna
drwxrwxr-x. 3 birch birch     4096 Nov 19 17:56 temp


Once you have verified that the FASTA file is in the getgenome directory, make sure to delete the remaining files from temp. We'll keep the empty temp directory for later use.

rm -rf temp/*

2. What's in the file?

Linux gives you some easy ways of finding out what is in a file.

Head - The head command lets you see the first few lines of a file, just to have some idea of what is in it.
 eg.

head GCA_000146045.2_R64_genomic.fna

will print the first 10 lines of this file

>BK006935.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome I, complete sequence
ccacaccacacccacacacccacacaccacaccacacaccacaccacacccacacacacacatCCTAACACTACCCTAAC
ACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCAT
TCAACCATACCACTCCGAACCACCATCCATCCCTCTACTTACTACCACTCACCCACCGTTACCCTCCAATTACCCATATC
CAACCCACTGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATAT
TGAAACGCTAACAAATGATCGTAAATAACACACACGTGCTTACCCTACCACTTTATACCACCACCACATGCCATACTCAC
CCTCACTTGTATACTGATTTTACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTCAGATTC
CACTTCACTCCATGGCCCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATGCACGGCACTTGCCTCAGCGG
TCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTGATATCTATATCTCATTCGGCGGTcccaaat
attgtataaCTGCCCTTAATACATACGTTATACCACTTTTGCACCATATACTTACCACTCCATTTATATACACTTATGTC

You could see a list of the sequences in this file by using the grep program to search for lines containing the '>' character:

grep '>' GCA_000146045.2_R64_genomic.fna

produces the output

>BK006935.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome I, complete sequence
>BK006936.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome II, complete sequence
>BK006937.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome III, complete sequence
>BK006938.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome IV, complete sequence
>BK006939.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome V, complete sequence
>BK006940.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome VI, complete sequence
>BK006941.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome VII, complete sequence
>BK006934.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome VIII, complete sequence
>BK006942.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome IX, complete sequence
>BK006943.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome X, complete sequence
>BK006944.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome XI, complete sequence
>BK006945.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome XII, complete sequence
>BK006946.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome XIII, complete sequence
>BK006947.3 TPA_inf: Saccharomyces cerevisiae S288C chromosome XIV, complete sequence
>BK006948.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome XV, complete sequence
>BK006949.2 TPA_inf: Saccharomyces cerevisiae S288C chromosome XVI, complete sequence

3. Retrieve the corresponding sequence information for S. arboricola.

If you go back to the page listing Saccharomyces species, you can find a link to S. arboricola. Click on
View in genome table.




Choose SacArb1.0.


Click on Download. Once again, choose GenBank only, and FASTA format. Download the zip file to your temp directory, and extract the FASTA file as before.

 Use the grep command to list the sequences in the fasta file .

>CM001563.1 Saccharomyces arboricola H-6 chromosome I, whole genome shotgun sequence
>CM001564.1 Saccharomyces arboricola H-6 chromosome II, whole genome shotgun sequence
>CM001565.1 Saccharomyces arboricola H-6 chromosome III, whole genome shotgun sequence
>CM001566.1 Saccharomyces arboricola H-6 chromosome IV, whole genome shotgun sequence
>CM001567.1 Saccharomyces arboricola H-6 chromosome V, whole genome shotgun sequence
>CM001568.1 Saccharomyces arboricola H-6 chromosome VI, whole genome shotgun sequence
>CM001569.1 Saccharomyces arboricola H-6 chromosome VII, whole genome shotgun sequence
>CM001570.1 Saccharomyces arboricola H-6 chromosome VIII, whole genome shotgun sequence
>CM001571.1 Saccharomyces arboricola H-6 chromosome IX, whole genome shotgun sequence
>CM001572.1 Saccharomyces arboricola H-6 chromosome X, whole genome shotgun sequence
>CM001573.1 Saccharomyces arboricola H-6 chromosome XI, whole genome shotgun sequence
>CM001574.1 Saccharomyces arboricola H-6 chromosome XII, whole genome shotgun sequence
>CM001575.1 Saccharomyces arboricola H-6 chromosome XIII, whole genome shotgun sequence
>CM001576.1 Saccharomyces arboricola H-6 chromosome XIV, whole genome shotgun sequence
>CM001577.1 Saccharomyces arboricola H-6 chromosome XV, whole genome shotgun sequence
>CM001578.1 Saccharomyces arboricola H-6 chromosome XVI, whole genome shotgun sequence
>JH806614.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold1, whole genome shotgun sequence
>JH806615.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold2, whole genome shotgun sequence
>JH806616.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold3, whole genome shotgun sequence
>JH806617.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold4, whole genome shotgun sequence
>JH806618.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold5, whole genome shotgun sequence
>JH806619.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold6, whole genome shotgun sequence
>JH806620.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold7, whole genome shotgun sequence
>JH806621.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold8, whole genome shotgun sequence
>JH806622.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold9, whole genome shotgun sequence
>JH806623.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold10, whole genome shotgun sequence
>JH806624.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold11, whole genome shotgun sequence
>JH806625.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold12, whole genome shotgun sequence
>JH806626.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold13, whole genome shotgun sequence
>JH806627.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold14, whole genome shotgun sequence
>JH806628.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold15, whole genome shotgun sequence
>JH806629.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold16, whole genome shotgun sequence
>JH806630.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold17, whole genome shotgun sequence
>JH806631.1 Saccharomyces arboricola H-6 unplaced genomic scaffold SU7_scaffold18, whole genome shotgun sequence
>CM001579.1 Saccharomyces arboricola H-6 mitochondrion, whole genome shotgun sequence


These genomes will be used in subsequent tutorials